Description :
From Genome Similarity Track
Location :
Scaffold_1662:6- 3497
Sequence
3491 bases(100 bases per row)
ACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCTATAGCGTCTTGGACAA
ACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGCTCAGCTCGTTTCCAGCAGTAGGCCCGGCCTCTGCGTTCGTCTT
CGCGGTGTCGGTGCCCTGCACAGAACCATTCTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTCTTGCGC
GTGGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGA
GTAGACTCGGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGG
CAGACACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCAACGAGCACGCGGTTCACGCGCTCGGTCTGCCCGACCGTCTGCGGATGG
TCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAGAGATGCGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCG
GCATGTCATGGTGTTTGAACACCATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATCTTGCTGAA
GCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATATACTGCCAACACTCCGACGGAGTC
GGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCGTCACACGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGG
CCCAGTAGAAGTCTCGCGCGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAG
GTCGTGGTCATTGGGAACGACAACACGGTCCGCGTTGTCATCGACTGCACTGTAAAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGA
AGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCATAGGTCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGT
CGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCACGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTC
GGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGAC
TTCACAGCTGTCCGCAGCGACGTGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAA
GGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCAT
CAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACTACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCACCTCAGTCAAGCCCCTC
TTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCACGTAGTCTT
TCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGG
GTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATGTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTG
CGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGC
TCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTTTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACCAGCCACTCCCA
GAGCATGCCGCTCGTCGTGCTCACTGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAGCCCATCGCGCAGATCAAGAGCACTGTAGATA
GTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTATGCATGAACGATGC
GCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCTAGCTTTGCGACGACTCTCAAAGAAGTC
GTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATATCGTGCTGGATGCCCTTGTCC
TGCGGAAGCTCCGCAGGGGTCTCTTCCGGAAGCACGTCCGCGTGCTCCCGTAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCAGCTCTTCTCCT
CAAAGCGCTCCTTCTTAGTCGTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCT
CTCGGCGTCCGAGAGAATGCATATTTACTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCACGACTGGAAGCGAAGTCAACTCCGAC
GCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCATCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCT
CCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGGGCCGTCTTCTTGTCCTGCGGAGCCCGGC
TCCGCATGACTCTTGAACTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCCAGCCCG
GCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGAGACGTTTGCAACCGTCCGCACCGCCTCCAGCGT
CGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGAC