Description :
From Genome Similarity Track
Location :
Scaffold_1497:6- 3396
Sequence
3390 bases(100 bases per row)
CACAATCTTGGATCCGATTCCCATCCACTTGGCACCCAACCTTACGAGCTAGGGCGGTATCCAGTATAGACACCTCGGCACCACTATTTAGGAGTAGGAT
TGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACCCCCCTGTTAACAGA
TCCATGGATCCAACATCCTCAGATCCACGGGATCCATTGACCTGACAGACCTTAGGGGGATCCGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGAC
CATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATTCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACT
AGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCTTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCA
TAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTG
CTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAG
CAATGATCTCCGGTATGACCTTTCTTGCCACACGTCTCACACATCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACC
TGACCTGGGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTCGCCGT
TCGATCGTTGGGCGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACT
TGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCA
CCGCCCGCAGCACTTCCTCAAGCTCATCTGCATCTGGAAGACGTAACAGGATTAGCCTGTCGGCCAGATCCACATCTCCCAACGTTACGATGAAGTGATC
CACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGGCCACATTTAGTCGATGTAGGGTATTCCAGCGGGGATT
CATCCGATCTGCGGCGAGCATGGTAGTATGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCGGCTTGTTC
CCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGACCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTAAGCATCCGACGCTTGATCTCTC
ATGAGGGCCGACTTGACTTTGCTTATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTA
CCCTCTGGATCATGGCCGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCAAGATCATCTGGGTCGAACTCATC
ATGGGAGTTGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGACACGGGCGCTCTCATACCCTGTTCG
GCCAGAAACCGACACATCGCAGCTTCAAAGTATCGCGGCAGGGTGCCCGAGGAGGTGTCGAAAGAGCCTGTGGCCGGCTGGTCCACTGGCGAGACAGGAT
CCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAACCCCACTGATTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGGGTAGG
GCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCTCGGAACCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATG
CGTCGTAGTTCGGACGACGTGTCTGACTCATCCTCAGAGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAT
TGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTC
GAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCT
CTTGGATCTTCGATCTGTCGTGGATTTAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTTGGTGGCGATACACAAACTCGAGATCC
TTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCATCTTCGTCTTCTTTCTCG
TTTCTTCGACTAGCGGGCTTGGGTTTGGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAG
CGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGGTCCGGATCCGGATCTACCTCTCTT
CCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGATCTCCGACGACGCCTCTTCCCCTG
GCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGTTCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCA
AAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCAC
CTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCAGTAACTTCCGAAGAGTTCAAGTAGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGT
GGAGCAGCAGTGGAAAATCTTCACTCTGCGTCTGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGG
CCGTAGGGTTGCCTTGTGGGTGTGTTCCCTTGCCTTTGTAGTTTCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG