Description :
From Genome Similarity Track
Location :
Scaffold_2102:6- 3219
Sequence
3213 bases(100 bases per row)
GCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAATAGCTCATTGA
TCAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTAC
CACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCAACAGTTTTTCTCGGAACTGAGGTGCCACC
TTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGCA
GATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGT
GGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGTTCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATGTTCGGTCTTT
GTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCGG
TCAGATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAAA
GCTTGGACCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCGTCCACCGACCCTGCGTTATCTAAGGGCCGACTCTAG
GGATCGTCCCCCGTCATGGATCCAACCTTCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGTCCGATCCA
CCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTTCTTTGTAGCGGC
GGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTATGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGTCGCT
GACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTCTTTCATGTTCCACC
CACTTTAACCGGTCTGGCAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCC
GTTCCGCTGAGCTGGATCCGCATCTCGTCAGGAAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGCACCATGAAATCCATCCCAAGGA
TGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTA
CACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATCGACACCTCGGCA
CCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCCGGGGCATGGTACTTCCAGTACCCAC
GGGACCCTCCTGTTAGCAGATCCATCGATCCAACATCCTCCGATCTATAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCGCCCTT
GGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAAC
TCATCCACTTGGCGCAAACTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCTTGCTACCTGGATCTAGCG
ATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACT
TCTGGCAACATCCCTTGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCAC
ACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCCGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCG
GGATCCGCACTGTGAACACCTGACTTGTGCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCAGTCGAGAG
TTGTCTCCGGTCTTCGCCGTTCGATCGTTTGCGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCC
TGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCGTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGG
CGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCATCTGCGTCTGGAAGACGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCA
CCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGGTGTAG
GTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGC
AAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATC
CGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCATTGCCCGTGAACTCCTTCAGATCCGAT
ATGGCTGAGATCC