Description :
From Genome Similarity Track
Location :
Scaffold_183:6- 3038
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G015025Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
3032 bases(100 bases per row)
TGGTTCGTTGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAA
GTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGA
ATTTCGGGCTCGCGCAGAGTTTTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCACAACGAGCTCGCTACTTGGTATCGAGCATCGTGGAC
GAGCCGATTGACATCCCAACGCAAGTCGTGACGTTCATGACAGGTCTGAACGATGGTCCGATTCGGAACCAGCTGTTCCGTGAGTACCCGAAGACCCTGG
AAGGAGCCATCAGCCGTGCGATGCAAGAAGAATTCAGCATCAAGCAAGCCAAATTCCAAGGTTTTCCGGCAAGACCACCAAGGCAACCAAACGTTGTTCA
TGATGGCCCAGAGCCGATGGACATCTCGTACATTTCCACGCCTGGAAATGAACGTCCTCGCAACGATGGAAAGTGTTTCCGTTGTGGGAAGCCGGGTCAC
TTCGCTCGGAACTGCAAAGTGTCTTTGTCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGACCGTAATAATGGTCGTCGGTTCGATCGTT
CCCAAAGGTCAAAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGAATGTTGTGGAAACACAGGACTCTGGCCCC
AATGTGCATGATGCACATGCAGTTTCCACGAGTGAGAAGAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGC
CTCTACGAGCTTTGGTTGACACTGGTGCGTCGAACAACTTTGTTCGAAATGAAGTGATTGCCAGGCACAACATCTCTGTGCCTGTTGCAAATGAAGAGAA
GACGATGATTGTTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTCGTTCGCTTGGCAATGAAGTGTGAAGATTTCCGAGGCGAGGACGAG
TTCATCCTTCTCGACCTCGATGACAAGTTTGACATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAACATGAAGATCT
CCGTTGACAAGTCATGCAGCGCTGACTTGAGCAGCATGACAACGGATGAAGTGGTATGGGTTTATACATCTGTGGAAGAAATCTCAGATGGCCCTTGTGA
TATTGCGGTGTGCGATGGCCCCCCATGTTCACAAGTGGCACCCATTTTGAAGAAGACAAACGGAGGTGGAGCAGTCAGGCGCCAGAAAAAGACTGTCTCC
TTTGCCATCGACGACAAGTTGCGTGCGATGGTAGTATGAAGAATGACGGGAAGATAGGCAGAGACCCGCCCCAAGACAAGAAAAAGAAGACCAGCAAGAA
GAGTGTTTCATCAAGAGTTTCAAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCAAGAGTCACTTCGAGCGAATTTGTGAAT
ATCGCGGTCTGCAAGGAAGAAGGTGACGTGAATGTAATCCGTCACGTACAAGTGGAAAATCCTCCAAGTTCTGTCCAAGAATTGATTTCCTTGCCATCGA
TGAGCAAGAAGACGCTGAAGCGTAGCCTAGCGAGAGGCGAAATCTCGCAGATCTGCATGATCGTCGATGTTGGCGATGCAGAGGACATCAGCACAGTATC
AGCAATGGAAGCTGAAGTGCTCGGTGAGAAGACACGGAAGGAAAGGTTCGAGGAGCAGTCATGGGACGCTCTCAAAACCAACCCCGTGTATGCACTTGCC
AGGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGACGAATTGCCATTTGATAGAGGCATTCGTCATGAGATTGACGTACTTCCTGGCACGAAGTACT
GCATCACAAGACAGTGGCCGTTGCCAAAGGAACAAGTCGATGCGATTGATGAGTTCTTTGCGCAACGTGCAAAGGCTGGCCATGTGCGAGAGAGTAAGTC
TCCGCATTGCAGCCCCACTTTCTGTGTGAAGAAAGCAACTGGCGGATGGCGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACCATACCTGCTCAA
ACTCCGGTTCCACGCAAGGACATGATCCTTGATGGAATGGTTGGCAGCACCGTCTTTAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGC
GCGAAGACGATGTCCCACTAACTGCAGTGAGTACCCATAGTGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCTCCTGCGACCTT
CAATCGAATGGTCACGAACGTTCTTCGTCCTTTACGAACATTTGCACCGAGTTACTTTGACGATATCTTCGTTCATAGTAAGGCCACGAATGGGAGATCT
GATGTTGATGTTCATCTTGATCATCTTCGTCAAGTTTTCCAGGTCATGCGTGAAAACAAACTGTACGCAAACTTGAAGAAGTGTATGTTCTTCGCTCCCG
AGATCCCTGTTCTCGGTTGTTTTGTGGGCAAGAACGGTGTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGAGCCAAAGAACGTCAA
ACAGCTGAGACAATGGTTGGGTCTGGCCAATTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCCCTCACACAGCTCTTGAAGAAAGAC
GTTGAGTGGAAGTGGTCGAAAGACCATCAAACGGCGTTCGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTGGCTTTACCGGACCACGACAAGC
CGTTCCATGTCGTCTGTGATGCGAGCGACTATGCCATCGGTTGTGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGTTGTTTCGTATCAGTCACG
ACAACTCCGACTGTAAGAGGCTATCCGAGACA