Description :
From Genome Similarity Track
Location :
Scaffold_2436:6- 2978
Sequence
2972 bases(100 bases per row)
TCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGT
CAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCG
GGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCC
AAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGA
CACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAA
TATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACC
TCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTC
TAGGCGTCCCGACGATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCT
ATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCC
TCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGCGCATGACGCGCCCTCG
AGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTG
AAACATGTCAGCGGGTCGACCCGCAGGCAACTCTTCGGCTCCACTACAGAGCCTGCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGGACTTCATC
TTTGGGCTTCCCGCCGACGGACTCGTGTCTAGCAACACTAAGTCCCCAACCTCAAATATACTTAAGTTTCCACTTCCTTGTTTGTCTGAGTACTCCTTTT
GTTTATCTTGGGCCGCTGCCATGGCATAGCGGACCATGCTGACAATGTTCAGCTTGGTGTCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGTCT
CACATCCGAGACTTGGGAGGAAAGGGCTTTCCGAGCCTCTACCCCACTTAGAATAGAGGCGTCGGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTAG
CGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAGCTGGAAGCTGCGTCGACCACGTACGTG
GTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTGGACATCTGCAG
ACGGGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCGGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCATCTCTGGGAGACCGTGATAGCGGAAC
ACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTAACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAA
TTCCGGTGTTGCCGTGGCTGTCGGCAGCAACAAACTGAAAGCACCGCTTCATCAGACCTTTTGCAGTCCTGGCCAGAAATGGTGCGTCGTACACCATCGA
CCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGCTGCTGACTCGCAGACCCCCCTTGAC
CCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTA
CGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCA
GGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCA
GGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAG
GCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTC
TCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAG
CAACGGTGTCGCGGGAAGCGACAGCTCCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGC
CCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTA
CCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTAACAGCATACGCTTGCTGATCAA