Description :
From Genome Similarity Track
Location :
Scaffold_2207:6- 2918
Sequence
2912 bases(100 bases per row)
GCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCGGAAG
ATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACTCGGGGACCGTGAGATGTA
CAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGT
GAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAAT
TCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTG
AATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATA
CACGTGATCTACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACTCTGGATCTACAAAG
AGGAGAGACACGTGGTTATTGGGAGAAACACCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTC
ACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGAC
AAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGT
TGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGAGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGTTGGCA
GGTTGTTTGGTGTATTGGCTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTGCCAGCCGGAGTGAGGTTGG
ATCTGGCGAATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTCGTATGGTGCGAAGATGAGGATCATAAGGGCAGA
TAAGACCACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGG
GTACCTACCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGC
GATGGTTAGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGGTCCCGCCGCTACTAAGAATGGCAGAATCTGGTGTACGAGGCGACTAC
CGAGATCGAATCGCTCGGAGAAGTGGGGCCCTCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGG
GATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCAGGATGGGGAAAGATCCCCAGAGTCGGCCTTTAGATAACGCAGGGTCGGTGGATGAAGGAT
TGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACGAGTGGATCCAGGCTTCCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAAC
ACTAGTCAAACCAGAACCGTCGGACTTAAACTCGTTAGAGGACCGACTAGATCCAACTGTTGGTCTTCCTGATATCAGGGTACCTGATTCCCCGAAGACA
GAAGAACTGCCAGGCGAAAGAAGGCCGCGGTGCTCGGATCCAATGATGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATC
TACACGCCGAGGGCCTGGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGATGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGC
GAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGACCGACATCTGCTGATTGATAAAGGTAATACGTTACCGCCCGCTGCCCGCGGAG
TCAAATGTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGG
CCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATA
GATTACCGGCTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCT
CTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCG
GATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGATCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGA
TCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGCTAGGACGCAGATCTTACATCGACGACA
TTCTAATCCCGG