Description :
From Genome Similarity Track
Location :
Scaffold_2971:6- 2704
Sequence
2698 bases(100 bases per row)
CGATCCGCTGGCTTGGGGACGATATGCCATGGTTGCCCGCTGCCTCTGCCCCAGTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTACCGATCATG
CCGAATCATCTCACTAGCTCCAAATCTCCGAAAAACACACTCCTCGTACGATCCGGTGATGGTTTGTGCAGTTCTGGACGCGCCGGTTTTGGCTATCACG
TATCCGGTAAACAGATCCACCCAGATCAACAATTCTGTGTTGCCTTTGAATGACATGGGGTAGCGAGGGGATGTGATCCAAGGCTATGATTTGGAACGGG
TAAGTCGCTTGGACGTTCCCAGGTGATTCCCCTTCGTTTGTGGGTCTGCCCTTGCCTGTATCACAATCCACGCATTCACCGAAATCTCGCTGCACACTCT
TGAATAGTCCCCTCCAGTGGAAACATTTCCGGATCCGTTGGTAGGTTCGACCAATTTACAGATGTCCTCCTTCTAAGCTAGCGTGATAGTGATGTAGGAC
ATCCTGTTGCAAGGATTCCGGCATCACCAATCTTATCAGTCCGTCTCGATCCCCGCTGACTCGTTTCGTAGGGGGATAATAGAAGAGCAAATCATTCAGA
TCCACTGCATAATCCGTAGCGATAATACTGTAGGATTAGGCGTCCTCCCGACTCAGGTCTCATACATCCCCCACCAGATACTTCTTAAGTCCTAGGATCC
ACACTTCTTCGTTATGTGCTTTGAGAATCCGCTCAATACGGACTCCCTTCACAAATGCTTCATCGAGAATCTGGGGGTTAGATCCAATCCTTCCTCTGGA
TCTAGTGACAGCCATAACCTGGACCGCCCGCTTCACGGATCCAACCGCCACCACTTCGTCTAGTCGGTTCGATGTGACGAGATCCTGGTGATCGGCCTCT
CTCTCCACCTCGACACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCA
ACCAACCCCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATAACCAAATTGGA
ATCCCCACAAATCACCAGCCTTTTTGGATCCTGTCCCTTTAGTAGATCCAAACCCAGCAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCC
GCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGA
AACTCAGGCCGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCAGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTC
ATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGT
AAAGCCGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTA
GCAGGTTATAATTTAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTGACGAA
GGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTGAGACCGCCCGGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCG
AAATGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTAGGTTCCATGAATGCTTGTTGAGCTCGGATCCACCGAGATTCTGTCTTTTCCACGTTCTGAT
CCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCTGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGACGTCGTACCACTTGGATCCCT
TCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAAT
ACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAAT
CGGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTA
CCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTCTCACACAGCTGATCCCACGATTCCGCCGGGATTAGGATGTCGTC
GATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCAGGATCCCCTGGCTCCCCTGCTTCGAATGGATCCACTTCTGCATTTCCTCCCCCGGATTCACCC
GTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCC
ACTCGAACAGGCCAAACGGCGTGATGAATGCGGATATTGCGCGAGCTAAAGGCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACA