Description :
From Genome Similarity Track
Location :
Scaffold_73:6- 2687
Transcript NameFunction/comments
Physo_139332pol protein

Sequence
2681 bases(100 bases per row)
AGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCATGAACCAAAAGGATCTTCGCACGTGGCTTGGCTTGGCCAA
TTACTTGCACAAGTACAGCGAGAACTACGCTGAGATGGCTCGGCCACTCTCCAATCTCCTGAAGAAGGATGCGGAGTGGTGTTGGAACACCGAGCATCAA
GATGCGTTCGCGGCCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTCTGCCAGACCCCGCTCGTCCGTTTAGTGTCGCCTGTGACGCCTCGGACT
TTGTCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGGCGCGAGCGCGTGGTGGCGTTCGAATCTCGCCAGCTGAAGGCTGTGGAGAAGAACTATCC
TGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTTGGGCTCTCAGCCGTTCATGATTTACACGGATCATGCG
TCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCGTTGGCTGTCCTTATTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTG
GCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATCTAACGACCGTGACTTCGTCATTACCGGATTTGATCCGAAC
GGCTTATGCTAAGGACGACACCTGTGTCGCGTTGGTGAAGGCTCTGGGGAGCAAGGAGTTTCAAGACTCGGTCATGGAATTGTCAGCGCGGCTACGCGCG
CGGCTACACCGCTATTCCCTCGATGGTGGCCTGTTGTTCTACAACACTGGCCCCGAGGATACGCCCCGCGTGGTCGTCCCTCATGATGAGGATCTGAAGT
ACCGCATCCTCTATGAGGCACACGACACGCCGCTGGCCGGTCATCTTGGCCGTGAGAAGACCTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGCT
GTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGCCAGCGAGCGAAGTCGTCACCTCATGCTGCAGCGCCGTTGGAGAGTTTGCCTGTCCCT
TCGGGCTGTTGGCAATCCATGAGTATGGACTTTGTGTTTAGCCTGCCGGCGGATGCGGCGGGCAACACTGGAGTAGTGGTTTTCGTGGACCGACTGAGCA
AGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAACGTACAGCAACGCTGTTCTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTC
AATTGTCTCGGACCGAGACCCCCGCTTCACGGGCAGCTTCTGGAGCGCGGTCTTTGCGGTGCTTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCG
CAGACCGATGGTCAGACAGAGCGCGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTGCGCCGAGACGCCGAAGCGCTGGAGCGCCATACTGCCAC
TCGTTGAGTTCGCGTTGAACAACGCCGTACACGCCTCGACAGGCTACACGCCGTTCTACGTGAACAGTTTGTCTCATCCCCGCGTCCCGCTGACGCCGCC
ACGTGGTGGCCTCGGGCTTGATGGGGGAGGAGAAGCCGATTTAGCTGATCGGCTAGCCGATGTCAGCCCGGATACTGTTCGTAAACAGGTTGACGCTTTC
TTGTCGTCGCGTCTCAGTGTCTTACGACATGTGCGTGACACAATGGCTGAGAGCCAAGACAAGCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATG
TTGAAAGTTATGAGGTCGGGGACCTGGTGTTGCTTAATGCTAAGAACCTACCTACACATGCAGTGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTT
CATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACGCTCAATCTTCCGAAGAAGATGCGGACGAACCCCGTCTTCTACGTGGGCTTGCTC
AAGCCATACCAGGACCCGACGCAGGTGCACCGAGGGTGACGAGGTCACAGGCGCGGAGGTCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGAGGACGCG
ACCACCCACATGGGCACCGCAGACACAGGCGGAAGAATCGGCGCCGGAGGTGCTGCGGGCACAGCGAGAGCCGCAGGCCAGGAGTCGCGGCAGTCGGAGC
CTGCATGCGGGCCAGGAGGTCGAGCTGACCCTGAAGCACAGCCTGCTGACGCTGTATCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAG
TATCGCACCCAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCACCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAG
TCCGGACCAGACGTGCATCGACGTCGTGGATATGATCCCGAAGGGGACCCGCCTGCTGCCGCACCTCCAAGAGCTCACTTTGAGTCGCGAAGGACCCCAC
AGCGGCCTCCACCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGGAGCGCCTCCTGGCGAAGCGGCGGTGCCGGGGTCAAAACCAGTATCT
GGCGAAATGGGGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCCCCTCCGCCAAGACTGCCCAGACGTCGT