Description :
From Genome Similarity Track
Location :
Scaffold_3133:6- 2641
Sequence
2635 bases(100 bases per row)
CCCTACGGCCGGTACACAAGGGTGGGAAAGTTTCAGCAGGGCAGGGACCATCAGGAGACCCCTCCGTTAGTCGATGTCTGGGCGCAGTTGGTAAGTTGGA
TCCAGCATTCTCACAGATTTTTGCTGATCCCCGCTGCCCCACACATGGCGCGCGTGCCCGAAATTTTTGGTGATTCGGGATTTCCCCGGGAATTCCCAAG
AAAGTGCTTCAGGGAAGTTTGAGCTTGGGGGAAGGAGGTTCTCGGGAGTTCCATTGCAGCGGGAGACCCTGATAAATTGAAAACAAGATCCCCGAATATA
GAGTGAATTTTGGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGA
CCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGTCAACACC
GTACCTAATCCCAAGCCCACTAGTCGAAGAAACGAGAAAGAAGAGGAACATGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGAC
CAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCACGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTTCTACATCAAGATCCTGTCATGCAGA
TTCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCT
TACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGA
GTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCGGCGGAAG
ATGGCTCCGACACGTCGTCCGAGCCCCGACGCATGACGTTAGGACCCTCCAGGGCATCCATGCTGGAAGCGCGGGAGAGGATCCGAGGACAAGAAGTCCC
TGTGAGCGTGAAGGCTCGGGATGCAGTACGCCCTACCCGTAATCTGATACAATCCAGCCAAGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCG
TCAGATCGGGCGCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGACCAGCCGGCCACAGGCTCTTCCGACACCTCCTCGGGCACCCTGCAGCGAC
ACTTCGAAGCTGCGATGAGTCGTTTTCTGGCCGAACAAGGCCGTGCCACAAGCGCAAGTGTTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCG
TGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGG
ATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGC
AAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGACCTGCTAGCGGGGCCGGCCAGGAACTGGTATCGGC
AGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCA
CGCTCGCCGCAGATCGGATGAATCCCCGCTAGAAATACCAGGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGGTGGAAGATCAAGGATGGGGAATCC
AAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGC
TTGAGGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCAGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGC
CCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTAAATCAGGATCCGACGGTTCGGACTCCGACCCGGAAGATTACCGTCGAGTCTGT
CTCACTGCGTCCAACGATCGAACGGCGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCA
TGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACATTAAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAA
AGGTCATCCCGGGGATCATTGCTTCTACGTTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCG
CCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTATAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCG
AGCGTTCTAGGTACTGCATTTATGCTTTTGTGAAC