Description :
From Genome Similarity Track
Location :
Scaffold_3387:6- 2398
Sequence
2392 bases(100 bases per row)
ACCGCTGCAAACAGGGCGTATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCAAGAAAGATGCATCGCCCGTAACGACTGTGAGAAGGACAATCGAC
TATGAAGACAGTCATAGATCGCCTCCAATCCTCTAGAACTCGAATGACTGAGTACTCCACTTGACGACATCCCCCATAGCGCTTACCACACTATAGAGAG
ATCCACTGAGTACACGCCTCGCAGTAAGAGCGTCACTCTCTCGACACAGCTGATCACACGATCCGCCGGAGATCAAATAACATAGATATAAGATCTGCGT
CCTAACACAGATGGGGTCCCAGGATCCCCTGTCTCTCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTA
TTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAA
CGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCC
AGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCC
CGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGAGGATGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTT
TTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCACCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAAC
GCATTACCTTTACCAATCAGCAGATGTCAGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCCGGATCCACTTGGATAT
CATCAATCGTGACTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCAGCGTGTAGATCCCCGCCTTCACGGTAACA
GACTTGCTCATCTTCCGTCTTCGTAGGATTCATTCATTGGATTCAAACACCGCGGCCCTCTCTCGCCTGGCAGTCCTTCTGTCCTCGGGGAATCAGGTAT
CCTGGTATCAGGAAAACCAACAGCTGGATCTAGTCGGTCCTCTAACGAGTTTAAGTCCGACGGTTCTGGTTTGACTAGGGTTGCCACTCTCGATAGGGAT
CCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTG
CGTTATCTAAGGGCCGACTCTGGGGATCGTCTTCCGTCCTGGATCCAACTTCCATTGCTTGGATTTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGG
AGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGAGGGCTCCACTTCTCCGAGCGATTCGATCTCGGTAGTCGCCTCGTACACCAGA
TTCTGACATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGT
CCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGAATACGGTAGGTACCCATTTCTCGCCCCGAGTGAC
CCACAGTTTCTCATGTTCCACCCACGTTAACCGGTCTGGCACCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATC
TTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGGT
ACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTACAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCC
GCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAGCCTTACGAGCAAAGGGCGG
TATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGG
GGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGA