Description :
From Genome Similarity Track
Location :
Scaffold_722:6- 2273
Transcript NameFunction/comments
Phymu_g11709conserved hypothetical protein

Sequence
2267 bases(100 bases per row)
CATACTGTCAACATGTCATTTGCCCCAAACTTATTTGTGCAGTGTGAAAGAGGAAAAGGCGTGTATCTTTTTCGAAAATTCAAATCTAGATATTTGCACG
AAAGTATTTTAGTCTGCCCAAAAGTGCATTAAAGACTTTAATgcaatgcacgaaacagctctaATGTAGATTAACCtgcaaagttcccaattaaaaaaaa
tgttttgtttttatatgGCGAAACCGATTTTGGGCTACGAACGaaactcatattttattagaGATCTCATAATTATATCAGCCGGGAGACATTTGTAGAT
AGATTGACATGTGTAGATAGAAGTCTGCCTGTCAGGTCGCGCGACTTTTAGTTTGAAAGATTTAGAAAACGTTGACCCGCAGATTGCCGGGGCACGTGCT
TGAGAAGACCGGACATGCAAGAAACATGTAGCTTTATTAAGGGCGAACAACGATCGTTGCTGTGACGGAGTGCTGTCATTAGCACTCCGCCAGCATtgaa
gtgcaagttgcattTGTGCATGTGTACCTACGTGCGATTGGCTAAAAATAGTTTCAAGTATTACGCCAGTTTGGTTTACGCCGTCAACCTGAGACATTGC
GAAGGTCttattggttgaaaatcGAGATTGTTCTCGAAGCTTCATTATGGGACGCCCAAGGGTCAAGCAAAACATTGCTACGTGGAAGTTTATAGGAAAA
TCATTGGTAAATAGCCAAATCAGAAGATAGGGAAAGATATGCTTTAGAATACACTCTACTGGATAGTTGGGAGATGGCTGTGAGCCACCTATAGTACCAG
GAACCGTAAGAGCCTTCCTAATTTCaattcacttttcaatttacCAAACAACGACCAAGTGGCCTCGACAACAGGCTTGTCCCAGCTTCGCCTCGGGCCC
TCGCTCCGCCGCCCAAGTCCGACGTCGCTTCCTCGCCGCAGCGCCTACTGTGTGTTacagttgctgcagcaaactcgagAACACTAAAGTACAAGTGGCG
CACATGCAGACGCGGATGGTTGGCCTCGACCGactgcagttcctcttcaTAAAGTACGTGTAGATGCTGAAAAAGAGAGGGTAGGGTTCAAACTATGTTT
TGCTAGGACAAATAAGCAGAATTAGTATGAATATTTTCTAATTTAGTCCAACGAAACCGTATTATTTGGCACTCTTTTGTCCAATGCGTAACTAAGACAA
GTCCTACGAAAGCGGCCCAATTTGAGCCACGGAACACATTTCAAGATTCTAAGGGCGGCTCCTAATGACGCTATGCCATGCCATGGCAAAAAAATAGCGA
TCTGATTGGACAACGAAAGGTCAGGACTAGTGTGGAAGTGCATGTAATGTTTTTATAGATGATGATGACATGTCGTTATATACCTATAATAAATTTAAAG
GGTTAACTTTAGAGAATTATCTTGAAAGTCGTAGTAAAAGAACTCAGCACCCACGTGGTGGCAAAAGCTCGGTGCCATTAAAAGTGCCCTTGCCATGCTG
TCATCAGTGGTGTATTTTTACACGGCTTTTTACTTAACTTAAGTGGAAACCGCTGTAAAaacgtaaaaaaaaatattattAAAAACGTGGAAAATGATGG
GTATCTCAGATCAACACCGCGAGTCGCCGGCGGGTGGAGCCACTGACGTAGCGTTCGTCCTTGATACAACAGCATAAGTCCTTGTCGGGCATTTACAGGG
GGTCGCTTGCGATGTTTATACTATTGGGTCTCCCGCACAGTGGTGGGAAGTCTACGGAGAAACGTTTCGTCATAATGCCGACGCCTTCTCTTTGCTGATG
TATAACACACAGAAGACCCCACtactgcagcttccggtGACGCACAACGCGCGCTTCCTGCCGCAAAAGGACAACTACGTGAACTTCTACGAGCGCCAGA
CACAGCGCAATGGCGTCATGCGCTCCCGGGACGTGAATAGCACCGAAAACTTCCTTTCTGCTGTGGCTTCAGCGACGAAAACCAAGCAGCCAGCATCCTA
GCAGGTGGGGAAGCATCTATGACGAAATGTAGGCTAGTAGTGTGTTGTCAGACTTTTAAAATGAAAACTGTGCTAATCTGACTCTACGATAGGTTCAGGT
ACCATTGCAACAGAGCGCAGCAAGATCGGCGTGAAAGCAGGAGAAAACATCAAAACCATTTTCCTTATTACGGCGGATGTGCGCCTGCCCCCAAATATTG
AGAAATTCCCTGAAACAAGTCTGAAGAGCAGGACTCTCGTACGTTCAATATTGTACTACAtgaactt