Description :
From Genome Similarity Track
Location :
Scaffold_3798:6- 2048
Sequence
2042 bases(100 bases per row)
CTCCTAGACATGGTCCATTGCTCTCTGGGTGGTTACTATTGCTGGATCGAGCTCCGCCGCAATATCCGCATCCATCACACCGTTTGGCCCTGTCCGAGTG
GACCCGGATGCTCGTTCGGATTGAAGAACGCACCCCAGATCTCCCAACGTCTAATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAACCCGAAAC
GGGTGGATCCCGGGGAAAGCCATACGGAAGTGGATCCATTTGAAGCGGGGGAGCCAGGGGATTCTGGGACCCCGTCTGAGTTAGGACGCAGATCTTACAT
CGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTG
GTAAAGAGCTATTGGTGGATGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCG
ATTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGT
ATTGTACGAATTGAGAGAGGTAGATTCTGCCGCGATGACCACTCCAGCTGTCCAGATGAAAATCCAACAAGCATTGGCCCAGGAGATGCCGGATCCACGA
AGGGATCCAAGTGGTAGGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCAGCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGG
ATCAGAACATGGAACAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTT
CGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTTCAAGAACATGAGGGGATCTGCTATCCAGTCACC
TTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCACTCCTGCGCGTGTTGGATCTGAATTACAACCTGC
TGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTT
ACTCTCGCCTTGGACGCTGGAGATTGTGAAATGCTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGAT
GAAGCGCTGACTAAGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTT
TCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCTAGATCCACTTATGC
GGAAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGAT
TCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGA
TGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCCGATAGCTTGGCCAGCGCCGCTTTACGAAATCAATGTGGTGTTGAAGTGGAGAG
AGAGGCCGAGCATCAGGATCTCGTTACGCTGAACTGACTAGACGAAGTGGTGGTAGTGGGATCCAGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGG
TCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGT
GGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGA