Description :
From Genome Similarity Track
Location :
Scaffold_383:6- 2017
Transcript NameFunction/comments
Phyta_totarag7786hypothetical protein PHYSODRAFT_531145

Sequence
2011 bases(100 bases per row)
ttagcacaagtggcgcctttgtacgcttaataaacacgtcatatctaaaaacggaggtctcaactcgtcttacaacccgagatataatctaaactgtgcc
aaaaaaacggggatcctaatgatttggcgcgcactgtaggAATCATCCACCGTTAACAATTTATCCCGAGTAAAAACGGGGTCGCTTACGATTCCTCCTT
CGTATAAAAAAGGCAGAAGTGTCATCCTTTTTGTGAATCCGCTCAGGATGCCGCTTCTGGGCGCTAAGGATTAATCCGCACTCTCCAGACTTCCGTGGAC
CAGAAGCTCCTCTTTGAATGTCAATTATCCCGGTTTGGCTTTGCTGGGTATTCTATTCCGTACAAGTAGCgtttattttttttaaatggGTTTTTCAGTT
AAAAACCCAACATGAAAGCGCCCTACTAAACCGATTCGTGGGTATGTAGTCTTTGCTAGATACTGCAGCGAGTCTTTGAGGCAGACGCGGTGCATCTGAG
CCGACAAAACAGACCAAATCAAGAGCATTTCGACACAGTCGAAACTTGAAGACAAATAGTTTTTGAGAAATGGAACAGAAAATTCAAAGTAATGATGTTA
GTCTACTCGTGGTGGGAATATACACTTCACCTACGCCAAAACATTACCAAAACCTTACGCGTCCTTGGCCACGATATCAAACCAACCTCCGAATGGCACC
TCCGGCACCGTCACGAAATTGTCCGAACCGCTGGCAACTCCAAATTcagtccacgacgacgctccGTTGGCCCACACCGTGTTGCCGTTGATCGAGATCT
CGATCGCGTCCAAAGACTTGCCAAATGTGGGCACTGAGATGGACCCCGTCGTGTTCTGCGGCGTCTCGAAGTGGGCCAGGAAGAAACTGTCCTCGTTCTT
GGTCGTCCACCCCACGGAGAAGTCGCCCGTCGCCAGCGAGTAACCAGTGCGCAGCTCTCCAATGTCCGCTCCGGCGGCGTGCGGAACGAACTCCCAGGTC
TTGCCGGCGTCCGTCACGGGGCTCAGACCACCGACGTGCAGCGTCAGAGACGCCGTCGGACCCGTGGACCAAGCGTGTGCGTGCGAAATGTAGCCGCCCA
GCTCGAGTCCGTAGAACGGGTACATGAGCTCTCCCGTCTCGTAGTACGCctcgatggtggtggagttgctgaACGTGTTGAGCATGTAGCCCCATTGACG
ACGGATGATCTCGAGAGCGAGCGACGCGTTGCCAGGGATGGCGCGCAGGTGAGCTTCCACTTCGACACTCGTGATGAACGGAGAGATGGATCCGAGACCT
TCGGGCGACACGGCGCCGTACTCGTTCCAGCGCGTGGCCAAGTTCTCCGAGACGGTAGCAGCCTGCTCCGACGACTGGGTGAGGTTGTAGCGAACCGCAA
GCGAGTTGCCGTCTTGAGGGTGAAGTTCGGCACCTGCGACCGTGGTGTTGTCGCGGAAAACCCCAACAGAGTCATCCCAGAGATTCGAGTTGACAGCCGT
CTTGACAGCGCTGGCAAGCTCACCGAAAGCTGTGCCATTGTAGGAAGGCACGTCCAAGCCGAGGTGCTGCGCTAGTTCACTGTAGCTGTACAGCGCGTGG
TAAAGAAGCGAGTTGGCGGCGATGTTCTTGCCACCTTGGCCCACACGACCCCAGTCGTAGACACCTGTGACGTTCAGAAGCATATCGGAAGAGTCCACGT
TGCCCAGGATAAACTCGAAGCCGAACAGGGCTTGGTCCCAGAGGTTCTCCAAAAACTCCGTGTCAACTGCCAGAATCGCGTAGTCGGCCAAGGCGATAAG
CGTCCAGATGTGGTACGTATCCGAGTTTATACCTGCAAGTTGGACACGAGGAGCAATGGGGGTACCAGCGTAGGCGAACTGGCCGTTGGTAGTGTTCTGA
ATCGCGTACAGAGAGTTGATGGCGTGGCGAACAGAAAGGAGGTTGTCGCCGTTCAGCGTTACGATCTTGGACAGCGTAGAGACACCAAAATCACCAGGCC
ACGGCGTACGA