Description :
From Genome Similarity Track
Location :
Scaffold_867:6- 1995
Sequence
1989 bases(100 bases per row)
ACACCACTTAGCCACTTGTCTGAGATGCGCGTGCAGTGTTTTTCCTTTTACCATTGGCACTGTAATTTTTGCTGCATACTCTCCTGCCCTTGCTCTCTCT
GGTTCCAGATCCACTTTGATGTCGCGCATTCTGGTCGAGCGTATTACTGGGTAGTCCTTTTCCTTTAGCGGCTTCCCTTTTTTGTTAATTACACACCCGT
TGTCATGCCAATGTGAATTCATCAAGAACTCCGTTTGTGCAGCGTTCAAATTTCTGGTCGTGATATCCTGCTTTGAGAAACGAATCTTATCTTGATCTAG
TTGGTAACTTGAACTCCGTGCAGCCCCTGCATTGATGAGAGTTGTGATGTTGTCTCTTTCTGCTTCTGAAGGTACGATACCGGCTGATTGAGCCTCCCAC
AATTCTGCTACTCCAACCGCCTGCGAAGTTGTCACTGGTGCTCCTCTTTTTTCGCGAAGCTGTTCTTTGAGCATTTGCTGTTCCGTAGGCCTGAAAAGCA
TCCCGATGTTTCGCATGTTCTGTTTATATGAACCGCCTCATGCCAGGCCGATGAATACGCGTCTTGTTCGGCTTGTATCCATTTTTCAGCAAGGTTACAT
CTGGTGGCCTGGAGCGCCGAGTGAATATCTTGTAGTCCTAGACCTCCATCATTCCTCGGTATGAAAACCAAAGCTGGGTTCAATTTATGTTTGGAGggtg
ctgttgctgttttcGCGTGTCATACAAATTGTTTTTGAAGATTCTCCAATagcttcttcactgcttTTGAAGAAGGATACTGCTTGCCTGTATACAAAAT
ACTCGGAAGTGCCACTACGTTAAAGAGAAGCACCCGTTGGTTGACTGAATTACTTATACTTGACGCAATCTTCAGTCGCTTTTGGATCTTGTTGACCTGG
ATCTCCCAGTTCTCTTGAAAAGTATCTTTATTTCCCACCCAGTATTCCAGCTGCCGTGTACTGTCTTCGGGATCTAGCACCGGAAACCCATTCCATTGGA
CTGGTGCCCCAGTAATATTCAATCCGATCAGAATACTCTTTTGTGGTTGCACTTGTAGACCAGACATACTCCCAAAATCCGCTAGTAATTCCTTTACGCG
ATCCGGTTCCTCCAGTGAGCTCATGAACACTGTACTATCATCCACAAATGACGAAAATTTGTGACGTACAGGCTGGTTGTCAGAGATTGCAATCCCTTGC
AATTGTTGGTTTTGATTGACCGATCTACTAAGTGGGTCGACCGCTAGTATGAATAGCAATGGTGCCAGTGGGCATCCTTGTCTAATACCCGAGTTAACCC
CATTCCTTCGACAATTTGCCATTAACTTGGTATTGGACCGTCGTTCCTTCGTGCATTTGATGAATCACATTGAGAAACGTTTCCGAGAATCCATATCTTA
TGAGAACTTCGATCATGTAGGTTCTATCCAGAGTATCGTAGGCTTTCCGGAGATCGAGGCACAACACTCccgcgctgctgttccacgAAGTGTCTGGTTA
ACTTTCACTTTGTCCCAGCACTGTCCGTAGCATAGTTATCGTTTTGTCGATGCTTCGCCCCCTCACGAATCCTTGTTAACTTGAACTTATGAGCTTCGGC
AAGACCTGATGCATCTGTTCTGCTAAGATTCTGCCGAATAATTTGTACGCCGTATTTAGCAGTGCAATAGGGCTGTAGTCCATCGCGTCACTTGAGTCTC
CATTTTTCCTCAGAGGAATCACTGTAGCTTTTAAAAAGGAATTTGGAactccatctccatccaTGATTGCATTATATAGCTTCGTTAGACTTGGCGTTAA
CTGATCTCCAAAATCTTTGTAGAAATCGTGGTTCAAGCCTGTTGTTCCTGCTGTCTTGTGTCGTTTAAATTTCTGGATTGCCTCCCAAGTTTCCAACTCC
GTTATAGGTTCCACTAGTGCTGTTGTCTCTTCACCGGTGACTCTGTTGTTCTCTGGGATGTTCACGAAAATGTTGAGACATTCATCAAG