Description :
From Genome Similarity Track
Location :
Scaffold_3194:6- 1778
Sequence
1772 bases(100 bases per row)
GGCTCACAGTAGACCAAGATCATCGCAAACAAAAGCCGAAGTTGAGGCGGCATACCTGAGGTCGTCGCTTCTTGCATGCACGTATGCCGTTCACTGTCAT
TCTCGAGGTATCCGGCAGCTCTGGCCGCGTCCTTGAATGTAGCGTAGCGGACTCTATCAATCGCTCGAAGACCTTGATAGGATTTCGGTCCACGTAGGTA
GCACAGTGGCATGCGCAAGAAATAGTGCTCGCTGTCCATTGGGCAACACCAAACCATTCGTTCAATCCCCTCCTCTCCACATTACTGGCAAATCTTCCAT
TTCTTTCCTTTCTGCCACGTGAAGTACTGCAGAAACTCGTGGTACAGGGAATTGGCTGTTCCTGGATCCTATGAGCATACCTCGAAGAATCGAGTGAGCG
TTGTGTGGCGCGAGTTGTTCAAAACACCGGCTGCGTCGTCTGATGGTCGAAAGGTGACAACATTACTCCCTTCTGTGTGGACAGGTAGCTGGATCACAGT
GTGTGACTTCTCTTGCAGCTTGAACTTGAAAATCCTCCAGTAGTCTTCTGGGGCCGACACATATCTTCCGTCTTGGAACTGCTGAATCTCATTAATGGCG
ACTTGAACAACTGTTTCACTCGGCCCAGATTGGCCACCTCCTTCTTCAACAGCGACCTTAGCTCGATCGTGTCACTTGTACACGTACTTGTAGAGATACT
CCACAGAGTCGATCGTTGAGCAGATCTCCGCGTTGACGTGGCAACTGAACTTTGACTGACAAATATGGGTTGTAGGGGACTACCCAACGGTTATCCATCT
CAACTCCACGTCGAAGCGTGGTTCTTCCATTATCCCGGCGCTTGTAGACTGGATACCCTTTCCCGCCATGTCGAGTCTCTTCGTTGAAGCTCTTCGGGAA
ATCTTTCGAGTACACACTGTCGCGCATGCATGGAGCAATTCGATTCAATGTACCACAGGGACCATGCATCATGCAGCTTGTCACCGCTTGGAATACGTGG
GGACTTACGTTTGGATCTGGAATTTCCGCACTTACAAACTTGTCGTAGTCTTCAGGAGTGTTGGGTTTTGAAATCTCGTCAAGCTTGATCAGCATGTGAG
AGTGCGGAAGTCCTCGCTTTTGGGACTCAATGACGTACACATACGCAGCCACCTTCCCGAAGATCTTCCTTCTGACGATATCGTCGATGATTGCTTTCAA
CTTCAACTTGAATACGCGAGCGACGATATCCGGACGGTCTTGAGCTTCTTGACCCGGGAGAAGTGCCTCTTTGATCTCCTGCCAATCGGGTTTGCAAGTG
ACTGTCACGAACAGATCAGGCTTTCCAAACGTTCGGACAATAGCCATAGAGTCGTAGTACTGCTTTCGCATGTAGCGCTCCCTACCGGTAAAGGTTGCAG
GAAGGACGATGTGGGTGCCCACGCGCTGAAGAGAATGATCGTTGTTGCTGACCATATCTTGGACTCCCTGGTAGCGCTCAGCGCGAAGTTCGCTCTGGTG
GGTGCAGATGTAGCGCAGTGCGTGCAGCTCAGTCTTCACATACTCCTCGACACACCATTGCTGGAACAATCTGGATGCGCGATGAATCAAATTAAACCCA
GTCTTCTTGACGTGAAGGCGATAGCCAACGAACTCTTTGATCGACACCTTGGTGTTATTGTAGCGAGCAGCATCTTCAGCATATCGAACCGCTGTCGACC
ATCCGTGCTCACCATAGACAAATAGTAGGGGGGAAGTGGAGTGGATCGAACGCTGGGTGCATGTCGGAGATA