Description :
From Genome Similarity Track
Location :
Scaffold_63:6- 1727
Transcript NameFunction/comments
g7344.t1hypothetical protein

Sequence
1721 bases(100 bases per row)
CAAACGAAGAAAGGTGAGTGAAATCGAAGCTACCCACCGTTCCGGAGTGATGGCCGCCAACAAGAAGGAAGGTAGGCTAAAATGGTCAAAATGGACAAGA
TGGACAAAATGGACAAGACACGAACGGCAAAAGGCAAAAGGCAAAAGGCAAGCCAAGTCATGAAAATAAAAGTGTTACTCAAGGTCAGCGAGTTTCGCAG
ACGAACCGCGAAGTGCACATTTGGGAAAGTGCTATTGCCAACTGATTTTATCACAGTAACATGATCACAGTGGAGAAGCAGGGTATCGATCCCTGTACCT
CTCGCATGCTAAGCGAGCGCTCTACCATTTGAGCTACATCCCCATGACAACACCCTACGTGCTCTACCACCACACAAACACTGCACACACATACACACAC
ACCAATACACCAAAACGGCACGCCCATCTACTGCCGCCACACACACACGCACACGCACACACACACGCATCGCGCATTACACACTCGCCACCTCAACCAA
GCGGATCGCCTTCACACGTGACCTCCATATCAGCACCCACCTCCCGCCACCCGACGAACCTATCGTCGCAAAACAAAACAAAGCCTTCCCCAACTGTATC
CGAGCAGCCCGTACCTGCCTGCAGTGGCTTCGGAGCTGGGCTCAGCTCAGCTCAGCTCAGCTCAGCTCAGCTCAGCTCAGCTCTGCTCAGCTCAGCTGGC
TGGCTGGCTGGCTGGCTGGCTCCGAGCGAAGTGTCTCTTCGACCACTCTCGCCCCACTCACTCGAAGCGGACAGCGCATCGACGACTTCTTTGGCTTGCC
AAGCACCACCACCAAGCACGCGCTGTCCACACACGTCAACGCTTATCCGGTCGCGTCGAATCAAATATCATCGTCGTGCGGTGTCGACATGTCTTCGCTA
GGAGATTGTGTGACAAGGGGTTCCAAATCGCCAGCGCAGTACCGTGCCGCCACTGCCTGTACGGCGGTCCACTTGACAACCAAGGTCGAGAGAACCCCAA
ACAAGACGCACGCGCACGGACACGTACTGAAGCCCAGCGACAAGTACGGCAATTGCAAGTCGGTGGCGTGGACTACATGGTGCTCGGTTCAAACGAAGAA
AGGTGAGTGAAATCGAAGCTACCCACCGTTCCGGAGTGATGGCCGCCAACAAGAAGGAAGGTAGGCTAAAATGGTCAAAATGGACAAGATGGACAAAATG
GACAAGACACGAACGGCAAAAGGCAAAAGGCAAAAGGCAAGCCAAGTCATGAAAATAAAAGTGTTACTCAAGGTCAGCGAGTTTCGCAGACGAACCGCGA
AGTGCACATTTGGGAAAGTGCTATTGCCAACTGATTTTATCACAGTAACATGATCACAGTGGAGAAGCAGGGTATCGATCCCTGTACCTCTCGCATGCTA
AGCGAGCGCTCTACCATTTGAGCTACATCCCCATGACAACACCCTACGTGCTCTACCACCACACAAACACTGCACACACATACACACACACCAATACACC
AAAACGGCACGCCCATCTACTGCCACCACACACACACGCACACGCACACACACACGCATCGCGCATTACACACTCGCCACCTCAACCAAGCGGATCGCCT
TCACACGTGACCTCCATATCAGCACCCCCCTCCCGCCACCCGACGAACCTATCGTCGCAAAACAAAACAAAGCCTTCCCCAACTGTATCCGAGCAGCCCG
TACCTGCCTGCAGTGGCTTCG