Description :
From Genome Similarity Track
Location :
Scaffold_4:6- 1721
Transcript NameFunction/comments
g3527.t1hypothetical protein

Sequence
1715 bases(100 bases per row)
ATCTCGTTCCCCGACGAGGAGGTCAAGATCCTGGAGCTCTGGGAGCAGCTGGACGCCTTCCACAAGTCGCTCGAGTTGTCCAAGGACCGCAAGCCCTTCA
CCTTCTACGACGGGCCGCCCTTCGCCACAGGCCTGCCGCACCATGGTCACATCCTGGCGGGCACCATCAAGGACACGGTGACCCGCTACGCGCACCAGAC
GGGCCACTACGTGGAGCGCCGCTTCGGCTGGGACTGCCACGGGCTCCCGGTGGAGAATGAGATCAACAAGAAGCTCGGCGTGACCACCAAGGAGCAGGTG
ATCGAGATGGGCATCGACAAGTACAACGCTGAGTGCCGCGGCATCGTGCAGCGCTACACGAGCGAGTGGGAGCGCGTGGTCAAGCGCATCGGCCGCTGGA
TCGACTGCAAGAACGACTACAAGACCATGGAGCCGTGGTACATGGAGTCGGTCTGGAACGTCTTCCGCACCATCTTCGACAAGGACCTGGTCTACCGCGG
CTACAAGATCCTGCCCTACTCGACGGCCTGCACCACGTCGCTGTCCAACTTCGAGGCTAACCTGGACTACCGCGACACGCCCGACCCGTCCGTCGTGATC
AATTTCCCGCTGGTCGACGACCCGGACGTCGCGTTTTTGGCGTGGACCACGACCCCCTGGACGCTGCCGTCCAACTTGGCGCTGTGCGTCAACGAGGCGT
TCGACTACGTCAAGATCAAGGACCTGAAAACGGAGAAGCTCTACATCCTGGGCGAAGCGCGTCTGTGCCAGGTGTACCCCAAGATGTCCAAGAAGGGCTA
CAAGGGCGGCGAGTTTGAGATTGTGGAGAAGTTCAAGGGCTCTGCGCTCGTCGGTAAGAAGTACGTGCCGCTGTTCGACAGCTTCAAGGACTGGCCCAAC
GCCTTCCGCGTGCTCTCGGACAACTACGTGTCCGACTCGGGCGGTACCGGTATCGTTCACCAGGCCCCCACCTTCGGTGAGGACGATTACCGCGTCTGCG
TGCGTGAGGGTGTTGCCGACAAGTTCACGCTGCCGGACCCGCTTGATGACAACGGTATCTTCACGGACGCTGTGCCGCTCGTCAAGGGCCTGCACGTGAA
GAAGGCTGACGACGTCATTTGTCAGGACCTGAAAACCCGCGGCCGTCTTGTGTCCAAGGGTACGGAGGTGCATAGCTACCCGTTCTGCTACCGCTCGGGC
ACGCCGCTGATCTACCGCGCTATCCCTGGGTGGTTCGTGAACGTGGAGCGCATCCGCGACCGCATTGTGGCCAACAACAAGCTCACGTACTGGGTGCCGA
GCTTCGTGCAGGAGAAGCGTTTCCACAACTGGCTGGTCGACGGCAAGGACTGGAACGTGTCGCGCGGCCGCTTCTGGGGTACGCCGCTTCCGCTGTGGGT
GAGCGACGACTACGAGGAGGTTGTGTGCGTGGGCTCGATCGCGGAGCTGGAGGAGCTGACGGGCGAGAAGGTGGCGGACCTGCACCGCGAGTTCATTGAC
CACCTGACGATCCCGTCGAAGCAGGGCAAGGGCGTGCTTCGCCGTGTGCCCGAGGTGTTTGACTGCTGGTTCGAGAGTGGCTCCATGCCGTACGCCCAGC
AGCACTACCCGTTCGAGAATAAGGAGAAGTTCGAGGCTGGCTTCCCGGCTGACTTCGTTGCTGAGGGTCTCGACCAGACCCGTGGCTGGTTCTACACCCT
TATGGTGCTGTCGAC