Description :
From Genome Similarity Track
Location :
Scaffold_3251:6- 1707
Sequence
1701 bases(100 bases per row)
ATCGTGGCACCCATGCCAAGACAGATGAGGTCGAACATGCCGAGCGTGCGTGCGAGGTCCTCCTTCTTTTCCTCGGCGTCGATCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTCGCCGACATGGTGCT
CGTGCTGTAGGCGGACATTGTGAACGGAGGCTGCTGGTCGCGTCGGACTTGGTGAAGTAGCGGCGCGCGTTCGGCGATGGCAACGAGGTTGTTGTTGGCA
GCGCCCAGCAGATTGACAAGTGATCCTCTGCCTTTCTTGGGACAGTAGCTCCTCGCTTGAGGCTCGATCTCGACTGGGAAGTCGGGCGCGAGAGACGCGG
GCATGAGTGGGGCTCACGAGTTGCCTGACTCTGTCGCGCGATCGCTGCCAACCACCGACACCAGCTGGTGGGCGAAGGCACNNNNNNNNNNCCAATGGGG
CTATGCGCTGAGGGTACCAAGAGCCATGTGACAGGGGAACGTGCCCAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACGGAACCG
AATGGACGGGTCCTCCCACAAGAAAATGCGTGTACTGGACCATGTGGTTTGAAGGGATTATCTAAAGTAGGCAGCTTACACTACATAATATATGGATCAA
AACCGATACTTGGATGCGCACGTTGTACATTAGTATTAACTGCAACATATGATACAATGTGACAGGTTGCCTATCAATTTGGATCTGTTCGTGGGAGGTC
TGTTTGGCCAAACAGCTGCCAATCCTATCACGCAAGCATCTCAGGTGCGGATGGGCGTCTTGGTGGGCGAGTGCTGGTGGGAGCAGCAAATGAGCGCAGC
ACAAGCGCTTCGTCACGGCGGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCATTGGCTGGGACTCTGCGGACGACAGAAGAC
GGAAACGTGGCGGTGCCGACGATCTTTGTAATAGCCTTTGTCGCATGTTAACATTAAGCCCGCAAAAGGCAGATGGAGATGAGATTTCGAATCGCTTTGG
ATCGGCGCAGATGATGCCTTCCTTCGGTGCTGGCTGCTGACGTGGAGCACGGGTCTCTGCACACAATCAGCACCTATGGGGGAGGGATAAACTGTGCAGT
GTTGCCATTTGTGGATCTCCCGGACTGGATGCAACAAAAGAGCTAGGACCACTCGCTTGCTCTCTATCTATCGGTGGAATACAATAATAGTGGTCGACCG
TCCACTCCCGCTCTCGCTTGCTGGCACAAAAGAAAGGCACGACTCACTACTGTATTCACATGATGCCGCTTGCTCCAGCAGCGAAAAGTCGTCATTTGCC
CAACCACCACAGCCCAGCGGATCCCATTGAGCGCCAGTGCCTGAATCTGTCACCTTCCTCTTCTCCTGATGACAGGCGCGTGGTGGGATCACGTCAGTCG
AATGGGTCTCCTAGTGCTGTAGCACTTGGACTAAAATTGTACGATGGGCTGTCGCACCAACTTCATCTTGACTCCGAGGGACCAGAGAACGCAGAGTGGA
GGGAGGAGGCACATGTGAGCCAACAGATGTCGAGTAGACCTTTCGAACCACCCAGTCTTTAACAATCCAGTGTTTAGCAGGTACAGTGCTGGTCAGTGCT
A