Description :
From Genome Similarity Track
Location :
Scaffold_47:6- 1691
Sequence
1685 bases(100 bases per row)
TTCGTGAAAATCAATTTCTGGTCGCTGATGGTTCCCTAGGGCCACTATTCGTGCTTTGAATCTGATCACATAGCTTTGTTGATCGGTCTTCACAGCATAT
ACCCACATGATATTTATTAAGATCGCCGTCTTCGTAACCTTTGTACCCTCAATTTCTGCAATCACACCCTTGGATTTAAGCGCATCCATTTCCTCTAACT
CTGCTTCTAGAAAGTATTCTTTCCATCACGAGTGCAACATTTCCTGGTGACTTCTAGGTAGAGTGATATCACTCGCACGAATAGGTTTTCCGCTTTGATC
CAAAACTTGCGATGAAATCAGGGCCATGTTCATCACGTAATCATCCAAACATCCTGTCTTCTTGCGTTCACGCAGTGTGCGAAGTTCAGTTCGCGTCCTC
TTGGCATCTTCATTTTGTGCGTCTTGCTCGACACGGTTTGCTTCAGACGGTGTCTCAGATCGACAAATACGCTTTCCAGTTATTTTATCAGGTTGTCGGT
CATGTGTCACTTGATCATCACGATCTGATCAGGACCTAATACGCTGGACAATGAAAAATCAATGCTTCCTTGATATTCGTCGTCTTCTTCGCAAGCTACA
GACGTTTCTTCGAAACATGGGTTCGAAGTTTTATCCGGGTCCGATTTATCTGTGTCATACTCGGCTACGGTCGACCCGCATGTACCAATTATGGACTATT
CGTCGTCTTCGAATACGTCGTTCGTTCTGAGCGCATCATTATCATCAGGATCAGATCGCCCATCTTTCACTCCCTCCAGATCTGTAGTAGCCTGAGAGGC
ATCCTCGATGTCACAAGTAGCTTCAGTCGCTAAACGCGCTCAGCATATCATCTTTAGATAACGTGTGTTGTTCTTCATCATCCTAATCAAAGTGTATCGA
AGAAAGATTATCGTCTGCCACTTCCGCATCATGTCGATCGCGGTTAACAATATTCTCGGTAACGCGTAGATCCGATACAAATTTCGCGGTGTGTTCTCGG
GTAAATATACATTGCACCCTACCACATCTTCTGCACAACAAAGAACAAACCCAATCTTGACATTTATATCATTTTTTACGTCCCGGCGATACTGGTATAT
GCGTATGCAAGAGCTCCAAACTTCTGATATGGTGTATATCAAGTTTTACTCCAAACATCATCTCGTATGGAATTCCCTGCGTGCATTTGTTGTAAACTCG
GTTTTTAACGTACATTACAATACGCAAAGCTTCAGTCCATAGACTTCGAGGACAGCCTGCATGAGCCATAGTTGATTTCGTCATGCCTTCAATCGACTGA
TGTGTCCACTCACACAGGTTCAGTTGTGAGCTTTTGGGTCCAATTTTAGCGTGCACAGTTCCTTTCGAGCTATACCAAGCCTCTATCGCATCATTGCAAA
ACTCGCCACCTTTGTCGCTGAGTACTTGCTTCACCTTGTATGAACAATTGCTGATGTGTCGACCGGCTTGTCGTTCTGCCCATACGCCCATAGTATGTAC
TCTTGCATACGCCGATTTATCTTCTTGCTGTCCTTGCTTGTGAGTAACTGTATGGTAATAAACCTCGAGTAACCATCCATAATAATTAGCACTACCATAA
TTTTAGTCGCATTCGACTGTCCCGGTAATTTGCAGATCCGCGTATACCACTTGATTTGGTTCATTTTATTCTCGATCAAGTTTTT