Description :
From Genome Similarity Track
Location :
Scaffold_283:6- 1607
Sequence
1601 bases(100 bases per row)
CGGGAATGCACGTCCGGTTGGCTGCTCCAACTCACTTGTGCGATCCTTGGCAAAACGAACTCTGTTTATCTGTCTCTCTGTCTCTCTGTCTGTCTGGCTA
TCTTCTGTCGATCTTTACATGCACTCCATCTTGACTTGTCTTCAAAATGGTCTTGTCGTCGTAATCGTCCGCGGTCCCTCGTGCCATACTTCCAGCAAGT
ATAATCATAACTGGGTACGCAAGCGAAGTTCAATGTTCCACGGAATCCGAACAGATCTCAGCTGGTCGGCTTGGTCGGTCGGAAACACCTTGGACTTTGT
ATACTGGATCTTCACATCTGGGATGGTATCTTGGTATCTTGGTATCTCCATTCGGGATTCATGATTATCTCCAAACGGGATCAAACTCCACTAGGGCGTC
ACATCCGGGGTATCTAGGACAGCTTCACGGTTTCTGGGTCTTCACTCAATCCAGTCGGGCTCCTCTTGCGTTGTACAGTGCACCAAGACCAGGCGGCCTC
CAGTCGGAGGCACTTTTACGCTCCCTTGGGCTTTGCCTCTCGTTCGGTACTTGGTTCCATCCGGGGTCCGCTCTTGGGGACATCTCCATCCGGGGTCACC
AAACCTTGTACACTGTCAACGCGAGTCCGGGCGGGATCCGCTTTTCCCATACGCCATGTGTCGCTGCCTCCCTCTCCCATAGTGAGCCACTGAGCCAACC
AATCACAGGTGCAGCTCGGGGAATCCTCGAAAATCTCCAATTCCATCGTGTCACCAGTTGACGTTGAACCCTCGAACGACGCAGAACTAGCTACAGAAGA
TGTCAGCGACGCTGAGAAGTATGCGGACGATGTGTGACGTGCGGCGGTCAGCAGCATGTCGATGGAACGTCGGACCGTACGACCACCGGAACTCCGGTAG
ATTGGTATTGCGGCCAGAAGAGTGGCAGGGCATCCTGCTCAGTTTGACCCTCAGGTGCAGCACTTTCTAAAGCAGACACCGCTGTCATCGAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N