Description :
From Genome Similarity Track
Location :
Scaffold_1401:6- 1584
Sequence
1578 bases(100 bases per row)
AGGTTAATTTACTTCGGGAGAGATGTCCAATCTGGATGCGGCTTATATCTCTCCCGAGCGAACGAGGTTCCCAGCGAGAGTTTCGTTTATTCACTGAGTT
TCTCGGTCTCTCTTGGGCTCACATAAAATACCAAGTAAAACAATGCCGCGTCGGGCATCCGGAAACCGCCAATCCGCTCGAGATCGAGTCGGAGCAGTTC
TATTGGAGCTACAAGAACATCGTATTGAGCGGGAACAAGACCTCACCCACTACTCTAATTCACCTATACATGAGGTGGAGAATGAAGACACCGACACGCC
AATGATGGACCCTTTTAGGGATCTCGGTGGCGCTGCAGCTATCAAAGCCATGACGAACTTCTTTCTACGCAAATTCAACGTGCTATGGCTCACTGTCCGC
ACCCACGCTCGCATGAATTATAATGTAGGGCGAAGCAGGCGATCTGAGATCAAGCCCAGAACTCTCTTTTTTCATGACACTTATTATGCTGAAAGAGGGA
GGGACGTGGGACAGCAACGCCAAGCGTTTTGGTTAGCGACGACGACCTTCACCGACATCGTTATCAAGTTCATCAAAATGTTGGCATCGAAAGCCTACGT
CGACTACGTTGGGGAGTGCTGTGATGAAGCAACAATGCGGAGGGCGTGCACAAGGGGCAACACCTTTGACAACAACCTGTGCGCCTTGTACGCGGTGGAC
GCCACCTTTGCTGAAAGGTGGCGTCCGGGCGGAAGCATCGGTGAGAACGGCAAGTTCTACAGTGACAAACACCCCCTGTACGGGCTCAAGGTCGAAGTTT
CTGTGGCCAAATGAGGAGTCGCGATCAATTGCACACAGCACGAGCCTGGAGCCTCACCATGTTCAAGGAGAACAAGATCCTCCACCTTCAAAATACAAAA
AAGCTGCCGGAGGATGAATCGCTGCCGGATGAAGGACCTCTGCTGGATGCCCATCCAAATGAATGGGCTATTCTAGCCGACAAAGGATACCAAGGGGCAG
CTGATTATCTTCGCTGCATTATACCGAAGAAAGGCAGCAATCAAAGTCGTGTAGACCAAAACAGCAACGACAAGATCTCGCTCGACGGCGTGATTGTGCC
GACTTACTTTGGACGCCTCAACGTAGTTTGGCAAATAAAGGCCGACAAATATCGACTGGCGCGGGAGCTATATGACGACGTGTTTCGACTGTGGGTGGGC
CTAGCCAATGTTTACGTCTCTCACTGTCCTCTCCGGCGCGAGAATGGAGATTGGTATAGACGGTCTCAAAACGAGCTCATTAAACTCGGCATCAAGCTCA
AACAAAAGCGCCGGCTGGATCAGGAGAAGTACAGGGCTAAGAATCGACGGCGAATCTCTTCCTCTCTGTCTGATTTAGGTGGGGGAGATGATGCGAGCGG
AGATGCTCTCACGCAGCTTAGTCAAGATTTTGGATCGCTGTCTAGGTAGTGTCCGAGTAGTGGAAATACTTGAATTTGACTTGATATCGTTTTGCCCGGA
AAAGATCGAGAATCACGGGATAGCATGATTTACCCCCGAATTGCTCGTTCCTTCACAGATGCTTCTGTCGCCCATGTG