Description :
From Genome Similarity Track
Location :
Scaffold_3312:6- 1518
Sequence
1512 bases(100 bases per row)
GTGTTATATAGATACGCTTGCTGTAGTTGGTGCAGTGATGGAGTCGATCCAGATGTGTGGATGTGAAGCGTATACGTACGACGGAGACGCGATCAAGATC
ACGCTGGCAGGTGTTTGTGTATGGTTGACATTGGTCGGGGATCTCGCTGTCAGACGCCATCCTTGGGATGGATTTCATGTGCCAGCCGGAGTGAGGTTGG
ATCTGGCGGATGGACACTTGTTTCCCGAGAGAGCGATCCACTCACGACGCGGCGTGTAGGGCTAATGAGATCTAGGGGGTAAGAGACCGATTGCGAACGC
GAGAAAACTCGGGAATCTGCCAGATGCGTTAGAATGAGGTGGAACTGGGAAAATGTGGTTCATCTGCGAGGGAGAAATAGTGTGCTTAGCGTATTCCAGG
GAACCAGTTGAGATCACATAACTTCCAGTTTCACGAGGGTCAGGGACAGCGACACCAAGAGAATTTTTACTGGACCATTATGAGGAGATCGGGCGATGGT
TGGCGAAGGACGGTATCCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATTTGGTGTACGAGGCGACTACCGAGAT
CGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAAATCGT
CGGATCGAGATCCAAGCGATGAAGGTTGGATCCACGACGGGGGATGATCCCCAGAGTCGTCCCCCAGATAACGCAGGATCGGTGGATGAAGAATCGCAGA
GGGCTGAAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGATCATAACTCCTAATGGGGCCAAGTGTCTGGATCTTTGTCGACAGTGGCCGCACTAGC
TAAACAGGAACCATCGTGGGTAAGCCCACCAGAGGATCAAGCCGATCCAAAAGGTGGCTTCCCCAGTACCAGGATACCCGACCCCACGAAGCCAGAAGGG
ATGACGGTTGAAGGAGAGTCGCAATGCTTGGATCCAAGGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCGTGAAGGCGGGGATCTACACG
CAGAGGATCTTGGGGAAGGCATGGCGGTGATCCCGGAGGTACCACGGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGA
ACCCAAGGAAGTGGATCGTCTACGTCAGAAGATCTGGGAAAGTCGACATCTGCTGATCGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAA
TGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGC
TGCAAGCCAAGATCATCAGCTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTA
CCGGCTATCTAA