Description :
From Genome Similarity Track
Location :
Scaffold_972:6- 1480
Sequence
1474 bases(100 bases per row)
CTTAATAACACCAACGACCAGCAGGGAAGCCAGTTTGGGCAACGACTCGGCAATAATGGTTCCATATTGGTGTCTGGCGTACTGAGATGGCCTCTCAGAG
ATGCAATCGATGGTGTTCGGCCGAACGTTTCCAATTCTGTGTTTGCGTTTTTGAGATATGCCAGCAATACATGATATTGGGCTGTCACAGGCAGCGCTCC
AAGAGCACGCGCACGCAACCATCAACGGGTAATGGTTAGTTCACATTCTCGAGGTTATGGGGATCTATGGCACGACAAGATTGTCGACTACTTGACCAAT
TAGGTGATGAATGCTGAGTCGAGTGCGCAAGACTAGTTCCCAACCACGAGCAAACATTTGTTTGTTTTTCATGGAGTGGCTCGCAACGGCTTCGACATTT
GAAACGAAGCTCATCTAGAGTCCACAGACACATGAGCCATGTCCTCTGGTAGGCAGCACCTGCGAAGGAGCGACAGCAGAGTTTATTTTCCCACCGATAT
CTTTGGATGTTGGGCGCCTAGCCGCAGATACAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAACGATACATGCGCACCATGGCCCCGCACGATAATTGATCTTTAAGCAGTCCTGCCAGGTCATGGACGT
CCTGACGCACCATGTATCGCTTTCGACTAATATGGACAGTTCAATGAGCGATTTTAGCAGCCACTTGCAACAACAGAGGCCCCGTGACTGCTAGGGTCGA
TACAGCGACGCCCGGCATCGCCAAGATCATGAGCAGCGGGTCTCCTGAACTCCAAGATCGACGGATTGCAAGCTCTCTTTGCGCGACATCTTGCTAAGCT
GATAGCCGAGGTTCGTGGGATGCCAACAAGACGCATTTATGTCCACGCCAAGAAATAACCAACTGAACAGCTTCACCAATATGTACGCCACAAAGAAGAT
CAGCGATCTTCACCTGCGCTGCCATATCCTGAGTTATAGACAGCAATTGCCGCTGTCGTATCGTCTAAAACGCGGCTTCAGTCTCTGCACGAAATTTGGC
AAGAGTACAGCGTTTGTATTCTGGGCCTGCCATTAATCGAAAGTCTAGACGAAACGTTCGGTTACACGTGACGATGAGCCGATTTTGAGAGCCGATATTA
TTGCAAACCTCAAGTCATCTACTGATCAATGAAGTCGCTTGCACAATGCATGCTTGGGTCAACATACACATACGGACAAGTAGGTGCGACCGGACACAAA
TCTGCGGCCACCCATTGGAGATGGGCTTTGTAGAAACGAAACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN