Description :
From Genome Similarity Track
Location :
Scaffold_3267:6- 1472
Transcript NameFunction/comments
Phyag_g13157hypothetical protein

Sequence
1466 bases(100 bases per row)
TGCTCATCGAATCGATGATTACATCTTTTCGCGGGATCGGCGTCTGAGCCGGTATCGTAGCATCGTTCAGCTTGTTGTAAGCGTGAACGATGCGCCAGCC
GCCCTGTGCCTTCTTGACACAGAACGTCGGGGAATACGTCCTTGTAATCCCGGAGCACATCGTAGTAGGGACTCGACTTGAGCGAGTCCCAGCTCTGCTC
CTCAAATCGATCCTTCTTCGATTTGGAGCTGAGGGCCGTGTCACCCTCAGGATGCCGCACGAGGACCTGACGTAGGTCCACGAGCTCTGTATCGATCTTG
ACATCCTCACGGGCCGTGAGGATGCATACTTGTTCTACGCGCCCGGCGCGTAGATCTCGGGCAAAGCCCTTCCAGCTCTGCACTTCTAGTGCTGTCAATT
CCGAGGCGGTGCCCGGAGGACACTCCAATGTCAACTCTTGACATTGTACGCCGGAGAGAGTCTGCATCAGCACATTGACTCTCTCATACACAACACCACC
TACTCCaggtgatgctgctgcgtcgcctgcGTCTCTTGGCGCAGGGTGCTCGCGCGACAGGGGATCTTCCTGTCGGGGCCCGACCCATTCCAGCAATGAG
GAGTCGGTTTCACTCCTCGCGTCGTGTCTCGCGACGCTTCGGTCGTCAGGACAGGCCTGACGACGACCCATATCTTCTGAAGCGACGGACCCGGTCCGTC
GTCTTATCTTGGCACTTGCCTTCGCAGACCGGGTCTGCGAAgggttcttcttggtttCCGCTCGCGGCCTGGCCTGCGAGGGGTCTTGCCCAAACCCGGT
TTGGGAGACGGTGCGCCCTCGGAGCGCACGCTTCATTTGAGAATTTGCCTGTGTCCCGGACACAGGTGAGGAAGCCTCCTGGAGGTCTTCCGCCATTGGT
TTCGCCTGCGTCCCGGACGCAGACGTGGGAGCCTCCCGGAGGTCTCCCGACTTCTTCACTCGCTCGCCGGTAGCGGCGGGTGACGTAATTGATTGGCTCG
GATGAGTGAGGGTGTCCTCACTCTCTACGTGCACACATCGCGGTGTACACGCAACGCTGACAGGGCCATCGCTCTCTGTGGCGTTGTCCATTATACCGAG
GACGCATGCGTCCTCGAAGCCGAACGACACAATAGACTGGGCCTTCCAGTCTATCACTGGGGCATGGCGTTTAAGCCACGGCATGCCCAATATCATGTCG
AACTTATCGTCCAAGTCCAGGACGATGAAGTCCTCTGTGAAGGTCCTGCCTTCACATCCAAAGCGAACTCTCACAGTTCGCTTGCGCGTCTTCACTGTTG
CGCCTGTCGCCAGGCGCACAACCAGCTCACTTCGAGGAGATTCCCTCTCCTCGGAACACATCGAGTTCAGGCTATGCAGTCGGACAAAGTTGTTCGATGC
GCCTGAGTCGACCAGCGCGTGCATGCGTCTGCCATGCACCGCTACCTCCAGGATGATCAGCCCGCC