Description :
From Genome Similarity Track
Location :
Scaffold_722:6- 1452
Sequence
1446 bases(100 bases per row)
ACGGGTAAATATTAAAGGCGCACACCCTTGCTGTGAGTGGCATTTGAGCTAACTGTAAGTCGTGTGACTTTCCAGTCAAAAACGCTTGCTCAAGTAGTAT
ATCCTACCTCTTCAATACGAGCTTTCCACAAGAACTTCACTAAAACAGACTTGTTAGCACCCTCATGAACGTTATTGCTCGTCGTGCAGTTACATCGTAG
CCGACGTTATAGATCAAATTTGGAATTTGAATTTGTTGGGCGTTAGACGGCTATCTACCACTACCATTACGATGTACTGGTGTAGCCTCACCAACAGTCC
ACATGCCTCGAGGACGCGAGTCTGCGGTAGTGGTCCACGAAATTATAGTCCACAATCTAGCTCGCTAAGAACGATGTCTGTTTGGTTCATTGCTATTTAC
TTGTGCAGTTAGTTGACTATACCCGATGTCCCTCGTTCTTATTCGATTCCAACACTCTCTGGGGTAATGAGCATTGTTGGTACCATTCTTGCAAGTTTTT
ACAGGATTGAATGTTGACGGTATTTTACCCAGTCACACAGCTTCGTTGAAATATCTAAGCCCATTTTCTCACTTCACCAACCTGATCGTTTAGCAACTTT
CGAGATTGACGCATGTAGCTGTTATGAATCAAACTAACTCGAGCAGTTTTGAATCCACTGCTCATATTAACTCGCGCGAGTTGTTTTGAATCCACTACTT
CATATTAACTCGCGCGAGTTATTTTGAATCCACTACTTCGTATTAACTCGCGCGAGTTGTTTTGAATCCACGACTTCATATTAACTCGCGCGAGTTATTT
TGAAGTAGACATTAATCATTCTTAGAGGTCAATAGGCATGTCGGCACGTGGTTGGCACCGTCCTGTTCGCGGCTCAGCTCGCCGCCACCTATAGACAATG
CCTGCGTCCTTTTGGGATACAGCATTGGTTTTGGTGTTGGTGGACCGTGATACGTAACCACTTTTAAGTACAGAACCGAGTAGTACAGGATCGGTTCTGT
ACACAAAAGTGGTTGCTGGTGCCCGTTTGGTGTGGTTGCTGGTGCCCGTTTGGTGTGGTTGCTGTTGTACAAATCGCAGGTTGTTATCGTCCTTTACTCC
AGCGCGGCGTCTCCGGTTGTCCACAAGGCCTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN