Description :
From Genome Similarity Track
Location :
Scaffold_938:6- 1382
Sequence
1376 bases(100 bases per row)
GAAGCTCAATCGAATCTCCGATCGCGATCTGCATTCCTTGATTCACACACACGTGTCTGAGGTTGTCGTTGTACAGCTGTCGTCGTCCGCTAAGCTGGAT
CTTGACTTCGTCGGGGAGACAGATGGAGCCGTCCGCAAGATCGAGGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGCCTCTTGTCCTGAT
AGATCGCCGACCCAGATATCGAAGAAATACACCAGCGATCCTACCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCACCAATCC
CCACACATTCCTGGCTCTGACACGTGTCGACATAGCACCCCACCTTACGAGCAAAGGCGGTGTCCACGATGGCCACCTCGGCGCCAGTATCTAAGAGTAA
GATCGAATTCTCATTGTTGACCTTGCCTGTGATCTTGGCCTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCCCCAGGAAGG
AGATCGGGCACCACATCGCCAGATCTGGGGCGTTCGCTGACGCGAGGCAGACTTCGATCGCGATCATTCTCCAGGATCTCGGTCGTCACTTCTCCATCAG
CTGCCTTGAACCATTTTTCCGGTCTGCGTTGCTTCCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGGGTCAGAACGGCTACAGTC
GCCCTATCGATGTAGACTTAAGACCTTGGCGGCAGATTTCGCATGCAGATCACATGTATTACCGCGTAGATCAGTCCGTCCACTTACTCGAACTACCGTG
TTCTTGTTTACGAATGCATATATGCAGTACCTAGAACGCTCGGCTCGTACCGGATGCCAACCCGGCGATCATCCTAGTTTAACATCTTCTCGGTGATCGC
GGGCAACATGCCAGCGTGCTTCACTGGGTTGAACCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGTTCACCGCCC
CCACGGCACACAAACAAGCAACGATCCGCCGGATGACCTCTCTTTCCACACTTCTCGCACGTCAAACGTCTCCAACAACCGAGATCGGTGTGTTTCCGCG
ATCCACAGTGTGAGCAGCGGCTTGATCGCTCCGATCCATCAGGCGAAGATCGCGATCTTGGATCCGATCGAGGTGAGCCATCGTTGATCTGTGCTTGGTT
GCTTCGATCCTGCTTCGTCGTGTCGCCCCCAGTGTTGCGAGACTTGTCCTCAGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCCGAGTCAGATCCG
TCTGATTCAGTGTTCGATCCAGACTCCTGGCTCGAGATCTGAACTGCACGCACTGCCCGCTTGATAGCAGCAGCTG