Description :
From Genome Similarity Track
Location :
Scaffold_1750:6- 1380
Sequence
1374 bases(100 bases per row)
TTTTGTGGTCAGTACAGTGTGGACGACCTCGCGAGGTACATTATCAAGTTCCCCGAACGCCGAGATACTGGTGATGACGCACACACGAACGTCCTATGTG
TGTTGCAATCCGTCTTTGACCGCTTGTATTAATACCAATTGGCAGATAAGGTGGCGGCTTTTGCTTCTCAGTAGCCTCTAGGCTGCACCGCAGGGGCAAC
GCCAGCGTGTTATTCAAGCGCACACAACCTGGTGCATGGTCGGTTAAGGCGTATCCATAGTCCGATTTAGTTGTACCACAGTGTTGTGCGAAGAGCAGAC
TTCACTTCAAATGTACGTGTTACTCTTTGAGGTCATGCAAGAGAATGCAGATATTAACGCTACTATCCACCAACAGGATACAGCTGGGGTATGGGCCAAG
ATCGAAGAACTGCTCACATCTCGGTCCAACAGAGTCGAGATTATTCCAGATAGCGAGTCGACAGGGCAACAATAGACCATGAATCAGCTACCGAACAACA
ACCCTCCGGAAGGAGACTACTACAGTGACCTACACAACATAGCTACTTTATTTGAACAACCACCAGTAACACGACGACACAAACTAGGACCTCGAACCAA
CTTAACCATCAGCACTCAAAACTTACGTGGATTTGCGAAGAAATCACGTCGACAATGGATGAGCGGGTGGCGTAGAATTCGAGGCAACCGAAGACCTGAT
ATTATTTTACTCCAAGACACACAACTAAAAAACAACCAAGCAACAAACCAAATGATAGACCAATGGCAAAGAGCATGGCAGCTATCTAAACCAGACCATG
ACTTGAGCTACTGGGCAAAAACAACGACGAAATCAGCAGGACTGGGTATCCTAGTAACACCCGAAATCAGCGCTCGAATCAAACCATGGCAGCAAGCAAG
CTGGACATCACGAGTGATGGCAGTAGAACTTGATGAATGGCTCATAATCAACATGTACGCACCTGCGCAGCACAAAGACCAAGACCAATTTTTCGCAGAC
CTTGAGCCGTGGATATCACAACACTCCTCCATTATAATCGGAGGGGACTACAACTGTGTACTACAACCTCACCAAGACCGAGTAACAGCCAGAAAACCAA
GTAATTCCAGCAATGAAAGCAAACTTCTCAGCACACTGCTTGATAAGTGGGACTTCACTGATGCTATCAGTCTTTCACGTAATTTGGATGACGATAAAGA
GGACCACGACCCTCTCCATTACTATACACATTGGACCCAGGACGGAGCCAGTCGACTAGACAGATATTATGTAAAAGGAGAACCCTTTACTGCAACACAA
TGNGTTAGCGTGCTGGAAGCAGCGCATAACTCCGACCACCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN