Description :
From Genome Similarity Track
Location :
Scaffold_3813:6- 1355
Transcript NameFunction/comments
Phyta_totarag15491hypothetical protein PHYSODRAFT_506784

Sequence
1349 bases(100 bases per row)
AGGAACACCAGGAAGACCCACGAGAAGGCCGTCATGGCGTACATGATAATCACTGCGTACGTGATGTCCGTACGGATGGACTTGTCGTCAGCTTGAATGC
GCTCCGTAGTCAGGTCGAACGGCTGGTCAATGACTAGCGTCATGGCCGTAGCGAAAGGTGTCGACAGGTTGGATACCATGGTGATGAGACCGTAGACGAC
GCCTTCGTTGCCGATACCAGACAGCTCGACGATCACGAATGCGGAAATCATAAAACCAACACCGTACGGAAGCTGCACCGCAACCGGCAGGCCGAGCCAG
AACCACTGGCTGCGGAAAACATCCCAGATCGTGATGAACGTGGTGATACCATCGACTATCATGACGAAGGCGCCAGTGAACATGATCATCCAGCGCCAGT
TCCAGTGCAGACCCCACTTGGACGTGACCATGATGCCAGCAAAGAACAAGATGTTGCCGAAGATGTCACTCAGCGTGCTGTTGATGGGAGTGACACCCAC
CATGTACGACTGCACGGGAGAGCTGGCCGTATACGAGATGCTAGAGAACATGCCTTGGAAGAAGCTAAAGAAGACGACCTGGTACATCACGCGCTTCTGG
ATCAATTCCCAcagctccttcatgtagTTCTTGAAGTTCACGCGAGGCTTTTTCTCTTCCTTGATAAAGAACCACGTCATGGGGATGACCGGCGTCGTGA
GGACAGCGAGAACGACCATCAGTTGCGggaagctgagcgagaagTCAAAGTCGCCGCCATACTCCTCGCCATTGAAGCAGAAACCAGTGAGGAGCTCGCC
AAGGATGACAAACACCGTGCGCACCGCATAGATCACCGACTGGGTCTTGCCACGGGTCTCATAGGGCTCGCGCTGCGCAAAGTCTACCACAATGCTGTCG
GCGCACACGTCCGATAGCACATAGCCCACGGCGGCGAGGAACATGAGCATGACATATTTGCCAGCCTGTGAGGCGGCGTCAGAGTTGATGCGCGCTTCAA
TCTCAGACGTGTAGTCGGCCGGCTTGATGTCGCGGTCGGACGACACTGTGTAGTATGGGTCTCCTGCCGGCATGCACGCCATAATGAGCAGCGAGATGAG
ACAAATGACCCACCCGATGACCATCCACGGCCGACGGCGGTATCCCCACAGCGGCACGCAGTCGGACAGGATACCGTAGAAACACTTGAAACTccacggc
agcaccaccagcgtcgccgccgtTGTCACTTGGGTACCCGATGCGTTCAGGTAGTTCTGGAGGAACGGGTAGATCGTGGCCGGCAGCACGCCGTAGTTGA
GTCCGACGGCGGCATACTGCACCAGTAGACCGATGCTGTCCTTGCTCTT