Description :
From Genome Similarity Track
Location :
Scaffold_4209:6- 1352
Sequence
1346 bases(100 bases per row)
ACGACATTCTAATCCCGGCAGAATCGTGGGATCACGTTGTGTGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATATCTCTATCAGCGTGG
TAAAGAGCTATTGGGGAATGCGCTAGGTGGATTACTTAGGCCATCGAGTCTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTTAGCAGACTTGTC
CTTCCCACAGTCGTTACGGGCGATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGATCCAGCTTACCAACTGCACCCAGACACCGACTAAC
GGAGGGGGTCTTTGCTGCGATGACCAATCCATCCGTCTGGGCCGAATAATAAATCCAAAGGGTTCTGGCCCTGGAAAAGGTCCGAATCTCCGAAGGGGAT
CTCCAGTTAGTAACACGCCCCGAAGAAGATCTAAAAACAGGAGCTGGATTCACCCGGGACCCACGCGAGAGAGGATCCAGTCTGGATAGAAACGACGATC
GGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGA
TCCAGAACGTCAACCTACGGTGATAGTTTATGCCAGTGACTGGGCAATCTCAGCAGCTCTGGTACAAGAACATGAGGGAATCTGTCATCCAGTCACCTTC
GTCAGCCGGACATTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAG
TGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCAGCCGGGTTGCAAGGACGGTTGGGACAGTGGGCAGCTTTACT
CTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAG
GCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAGCGCCAGATTCAGATCCCGATTCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCG
ATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGGAGACTACTCTGGGATGGGAAGTTGTACGGGCTAGAGCTACTTATGCG
GAGGCCTCACCGTCAACGAAGCGGAGTATAACGGGCTGGGTTCGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTTGCGGGGATTCAAATT
TGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCTCGT