Description :
From Genome Similarity Track
Location :
Scaffold_3869:6- 1269
Transcript NameFunction/comments
Phypl_g16069hypothetical protein

Sequence
1263 bases(100 bases per row)
CTTGAAGCTGGTCAAGGCGGTGACCGTCTTCTTGGAACGAGTCGATGGGAGGTTTACGGTCTCGGATGTCAACGATCGCCTTGCCAGCCTTGAGGGCATT
GTCCGATTCTCCCATGAACGACGTTGCGTTGCCAATCCCTTGAGCTGACATCATGATCGCCATGAGTGTTCTCATGAGCTCTTTGAAGTTGATTTCGCCA
TCGTTCACGAGCTTCCCGCCGTACCAAAACACGAGCGAGTACGTGGCAAAGAGAatgaaggagctgaagcCCAAAGCGACGCCGTTGAGCTgggcttctc
gtcgtccactcGCCAGCGGTTCCTCGAGTAAATTGGAAAATTTGGTGCAGATCGACTTCTCCAGCCCCAGCGACACCACAGTGCGGATATTGCTCAGCGC
CTCGGACGCGTGTGCACCAACATCCGACAATTCATCAGACAAATGACCCGAAGACTTCATTTGACGCATGCGAACCATTTGGCCCGCAATGAGGAAGGGG
AAGACAGCGAGCATCACGAGTGTGAGCAACCAACTGCCCGTCGTGAACGAAATAACCAGTGCCGCCACAAACGTGAAGACCGCCTGGACCACGCGGCCCT
GCGAGTCGCCCGAGATCAATGCAACTTTCGTCGCATTCATCGAGAGATCGGCCGTCAACGCTCCAGTTGCGTTCTTCTTTTCGTCAAAGAATCCAACGTT
CTGGCGGCAGAGCGCAGTGAAGTGGACATCGCGAAGTCGAgacgtgagcttctcggccatgTACTTGAAGCAGTAGTTCTGCGTTCCCGCGGCGAGGAAC
ATGACCAGAGATCCACCGACGTAGCAGAGGCCGTAGACCATCACGTCGTGCTTGAGATCGTCGAGGGCAGATTGGACATTGGAAACCTTGTACAGCGTAT
AGTTCGTGGTCATGGTAGCAACCAGCTCACTGATAAGAACGGCCGAGCTCGGCAGTGCACAGCCCAtgacgccagcagcaaggatGCCCACAACGAACGC
AGGTCGCTCCGGCCTGGAAAATGCCATCGCGTCGGACAGCGCGAATGGCTTCTCCCCGCCACTTTCGATGTCGATGTGAGCcatcttggcctcctccaaG
TGTTCACTTATCACGGATCGGCTACTGCGCTTCCGCAGCGTCTCCGAGTGGGGTTCGCCATCATTGGCTTGTGCCAGcgaactcgctgctgcttcagcct
cttcctgcgccttctcctcctgaATTGTGTACAGCTTCCGATAGATTCCGTCCTCAATCACCA