Description :
From Genome Similarity Track
Location :
Scaffold_754:6- 1195
Transcript NameFunction/comments
Phymu_g11841conserved hypothetical protein

Sequence
1189 bases(100 bases per row)
GGGTGGTGTTGCTACCaagcactgctggtacattCCGCTGGACGGTGGCGAAGGCAAAGAGTGCTAAGATCGAGGTTGTTTGAAGACGCTGTAGTCTACG
AGCGTTATGTAAAGACTACGCAGCCGTTCGTAGACCTCGAGCTACCATGTCAAAGAGTTTGTTTAGATAAACAACAACATGTTGATATTTGCCGTGTCCT
GAGTACAATTTTAGAAAAAAggtttaaaaaaaaagatgaCCTCGTGGCATGGATTCCATGGCACCAACCTGTACAAAACTTTGCAATCCGCAACGATGAC
ACACAGAATTACATGAACTTCCAGTATTGTAAGATTGATACCAAGCTCAGAAAACTTGAAAACTGTGCGTGAGAGCGTTTGTGTGATCTTGCGATGGAAA
GTCTTTAACTGAACTATCGATCGTGAGGCGCACAACAAAGCACATGCCTGTCGTCGACAGACGCTGTTTGGTGAACTAGTCAGTGGGCTGTTCGTGCCGC
CGCTGGATCGGTCGGGAGTGCCTGCCACGATTTCCGCACCATGTGTTGCGGAATGGCTCCGACACTATCGCAGATTAATTTACGGGAACTGTTAGTCGAG
GCTTCaacagcaccacgacgcaATTCTTGCAATGGAGAAATGCACGACAGTAGATGGCAACGTTGGCTTGCGTGCACCATTGCTTGCTGCCAGCCAGAGT
ACGCAATACAGCAATACTTAAGTATAAATAGTAGCTCCTGCAAAGCAAATTCCAAGTTGCAAAAACTTTCGTGGCTGATCTGTGGGCAAAAGTGCGACAC
ATAGATTTTAGTCCGCACCAGATGGAAAGTACAGTTAAAGATAAAATATTTGGATGCTGTAGATAATATTAAAATATCAAATGAACAAATTATCACAAGC
TTTTTATACAGCACAAACGGCAAACACAATACGTTATATAAAATAGGTATAGAATTTTACAAGCGACCAAATTTCGCACTACTGTACTGTTGAAAAGAAA
TCAGATGCGAATCTTTTGCGCACAAGGTTTTTTTCATCTTTCGAGGTTTTATCTGTTCCGTGGGTCAACCTATCTTGCCACTCTTCAAATTCGGCTCGAG
TGGACAAGGAGCTCTTTCTTGGCTGCGTGTGAATCAGGAGACAAAGGACCAAATGGTGATCAACAAGCGCCTAGTAATTATTGGCATCG