Description :
From Genome Similarity Track
Location :
Scaffold_4004:6- 1192
Sequence
1186 bases(100 bases per row)
GGAGTTTTCTGTCGAATCTGATCCAATCAGATTCTCTGTGTCGTTTCCCAGAATCGACACACATTCACTTCCAACGACTTCGGAAGTCGTTGGAGCTTTC
TTTATTCACGCCCTGCGCGTCGAGACAGCAGCGTTAACCGCTGTCTCTACTGGAATGCCGCATGCACCTTGCGGTGCACGTGTCGCGCTGTCGCGACCGA
AGCGTACGATTGtacgcttcttccagttcatTTTCGGGtcatgcccagcaccaagtcgaacttgtcgtctaaGTCTAAGACGGTAAAATCCTCAATAAAT
CTCTTTTGTTGATATGAGAAGCGTATGGCACGCTTCTCGTTTTTCACGACGGCACCTGTTGCCAGTCGTACTTTCAACATGCTTCGAGGGGtttgcacct
cctcgaagtcaaCGCTTGGCAGAGTCTGCAGTCGAGCAAAGTTGTTCGACGCACCGGAGTCTACTAAAGCTCGAAGAGAGTTCGCTCTCTTCGAAgacac
gtccaggatgacaaGGTTGGGCTTGTCATCTCGCTTCTTGCAGTGAGATTGCCTCTCACTGGGGGCCGCAGCCTTCATTGACGCGTGTCCGATGTCGACA
CGCGTGACTGCTTTACCAGTAGGGCGTCCCGCGCCTACTGGTTCCgcgcgtttttttttaatggATCGTAGCGATGccctgcatcgccacgttgACCTCT
CTGCCCGTGCACAAGTGCTGTGCACTCACGCGCAAAGTGACCGATGCGTCCGCAACGGAAGCATCGTACGTCAGCTccgcgacgtggtgggtTGTTCCCA
GCCGTCGCGTTCAAGAGGTCCATTGGTTCTGGACCTCCCGTCCTTATCATCGGACGTGGCATCCGTGGCACGTTCACATGCAGTTTAGCCTGCTTCAGGC
TAAACTCTTCTTGCATTGCGAATGTgatcgcagcttcgagagtACTCAGGTACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCCTTCAGACccttcat
gaacgtgacgaccTTAGTCGCCTCGTCTATCGGGTTAGTCACGATGTTCGAGACCAAGTACCGTGCCCTCTGGGCGTAAGCATGGGCATCATACTTACCC
TGCTGTAGATCGAGGAACTCTGCCCTCGATCGGAATTCGTTTTACGGGGCTCAAACGCTTGTCTGAGCTCCTCCTTAAAGGTCTCG