Description :
From Genome Similarity Track
Location :
Scaffold_3385:6- 1119
Sequence
1113 bases(100 bases per row)
TCCAGATTTTGACGCAGCAGCGGTGGATCCCGTCTTGGACGTCGATCCCGGTTTGGACACCGTCGATCCCGTTTTGGACGTAGCAACTGTGGTGAAGTGC
TTTCTCAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTG
TACATTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGA
CTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCG
GTGCCCTCTGACGGTGGATCTAGTAGCCACGGCTAATGAGGAGTCAAAATCCACCGCGAGGTACCCCGGATCCCATACTTCTGAGTTCGTATCCAAGGAG
GGAGGATCCCGCCTGGAGGGACCTGGATCCAGGGTATAGGGATGAGGGATACAGTGGATCTCGAACTTTCGTGGGACAACGGAGATCACAGACGGTTGCG
AGATGATGTTGGATGATTGGAGAGCTCGGATCCACGGCGAGTGTACCATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAAT
AGGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGT
AAGGGATTTAGCTGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATTTGCACTGTGGAGAGCAAGTGA
CCTGAAGTCGTCGCGGGGGTTGGATTTGGCCTCGGGCGATCGCCGTAACAGGACTTAACATTGGCCCTGGACAAGAACAGCGTCTACTTCGCCCGCCAAG
CATCAGGTCTCACTATGGAGTAATCAAGATCACGAACTAGAGAACAAGTGGGCACGGAATCGTAACGGGATCATCAAGTGGAGATCAACTACGTATAGCG
TTTCGACGGGGAT