Description :
From Genome Similarity Track
Location :
Scaffold_362:6- 1116
Transcript NameFunction/comments
Physo_125738hypothetical protein

Sequence
1110 bases(100 bases per row)
GACATTACACCTTTTCCAGGCGTAATTCGCGGTGTGCAAATACAGTTCGGCAAGAGCAAAAACAAATTCGTGAAGTGCAAATCGAAATTCATCAAAACCT
CCATAATAGCGATAAACTATCATATATTATTCTCTCCAAAACATTATTGTTTTCATTATAGGATTAAAAATAACATTATGGCTGTGAGCTTCGTGCGCTA
CATCTGCATAATAAGGGTGCTGATGGAATTGGCACAACAGGTTCTCCATCGTCTGTAGTACATGTACACTCTCGGTAGTCCCGTTACAGCTCGTGATTAT
CCAGCCAGAGGGGCCCTGGTCTACGACCGACCAGCTCATCAGTCTATGTCTGCTGAAAATAAATATTTGAAGAGTCGCCTTCCATGATTCATTCATGGAG
GCTTTGATGAATTTTGATTTGCACTTCACGAATTTGTTTTTGCTCTTGCCGAACTGTATTTGCACACCGCGAATTATGCCTGGAAAAGGTGTATACGTTG
GCAGGAGTGTCGGCGGCTCATTAACCTACCCCTAACGTTGACGATTGGATAAAAAGCTATCCATCGGCCTCCTCATTCGACAATAATCGTTTATCGCCAT
TTGATTGGACCACATACAGTGGATAAGTAGAAAAACATATGTGTCGGCACTTTAACGATACCGACGACGCACGCACCAGAAGGATGCGTGGGCGTAGGTC
ACTGATTTGCCAAGAGCCATTTGGCTGTCGCAGACCAAACCCAACTAACTATCCACCAGTCGTTTTAGCCTACGCTGTGACCGCAAACACTCCACGGAAG
CCAAGTTGGAGGTGGCTCAGTGGACATATAGGCTCTTGACACGTGTAGGCTGTGTACGATGGGCCGGCGGGCTCGCCAGAACGCGTTATGCATCCCAAGG
CTAACGTTGATCGCAAACCGAGCGGTTTTGGGCTACGCTTTGCTTCGGTGTCGGGCAAAACGCCATGTGCTGCGACTTCTTCCTCGACTCCCAGAAAGAG
TTCTCATCTTGGTCTCCGCAAGCCGGCAGCCGAAGCGCCCGGTTACGAACCCACCACCCAGGAGCCGGAAACCAGTCGACAAAATCGTGACGATCCCTAC
CACCCTAGCA