Description :
From Genome Similarity Track
Location :
Scaffold_2245:6- 1091
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2245-fgenesh-gene-0.1Major Facilitator Superfamily (MFS)
Pytar_ATCC12531maker-par_contig_2245-snap-gene-0.2Gene of unknown function
Pytar_ATCC12531maker-par_contig_2245-snap-gene-0.3Gene of unknown function

Sequence
1085 bases(100 bases per row)
AGCGGCCGCGCAAACGCCATGAGGAAGAGACAGATGAGCGAGAAGCCTCGAGTGACCACGATAATGGGCATGCGCCCAAGCGTGCGTGAGATGCGCTGGC
TGGCCACAGAAAGTATCATGACGATGATGGGCTGCATCATGAAGAGAAGCGTCACGTGGATCGGCGTAAGCCCGTACTCTTCCTTGAAGAAGAGCGGGAA
AAAGTTAATCGTCATGCCGGCACCGTTGCTGATGATGAAATCTGACGCAAAAATGAGGTACGGAATGTGGGTCAAGTTGAAGCACCAAAAGGTCGCGGTC
TTGTGCGCAGGTGCGGATGATGGATCCTGGCCCACGACCAGCGCCGTCTTCTCTGTGGGCGGCGCGGTCTGGTTCACGGCGTCATCGTCGTAATCGTACT
CGAGCTCCATCTCATTATTGACGACCGTCGGCGTACACAACGGCGTCTCGCTGACCTGCGACGTGCGGCTCAACGACCGGCGCTGCGCGGTTTGCCCCAG
TTCGATCGTACTATCGTTTTGGTCGGTCGTGGTCGTGGGCACGGTGGTCTCAAACTCGTTCTCGAGTGCGTAGTCGTCGTTAAAGCGGAACAGCAGCACG
GCCGTGATAGCCATGAGAAGCGTACCAAACTTGAGGACGGCTGTGAGCTCATGGATCTGCCACACGTCGCCAAAGTAGAGGAACAGGAACACCGAGATGA
GCGGGCCTAGCACCATGGCCAGATTGCCAATGTTGTACTTGATCATGAACGGGTACGAGCGCTGGCCATGGGGAATCGAGTCGGCGAAAAGCGCCTCCAA
TGCCGGGTTCTGGAAGGCCGAAAACATGCCCCAGACGCCAAAAACCACGTACAAGAGCGTGAGCGACGTCACGTCGACAGCGACGAACGTGAGCGCGGCG
GCGCCGAGCCCCATAAAGGCCGAGATCGTGAGGATCGTGTCGCGCCGCGTCTTGTCGGCAAAGTATCCGGCGGGGAGCGAAAAGACGAGCTGCGAAATGC
CCTGGATCCCCTTGACGACGCCCACGGGCTTGTTGGACTGCGTGAGCACGAAGACATAGCCCGCGACGATCTGCTGGAAGAGAAT