Description :
From Genome Similarity Track
Location :
contig_153:6- 1076
Transcript NameFunction/comments
g13849.t1hypothetical protein

Sequence
1070 bases(100 bases per row)
TACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCACCTGTGAGCTGGGGAAGCAAGA
AGCAGTCAAGTGTGTCGCTGTCTACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGAT
TCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCC
AAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCA
TGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGT
TACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGA
TTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGATGAAGTAACTCAGTATCCAGTAAAGAATCAAGT
AGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCA
GTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGTCAGGAACACGCCAC
GCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCAT
AACCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGA