Description :
From Genome Similarity Track
Location :
contig_153:6- 1074
Transcript NameFunction/comments
g11742.t1PREDICTED: copia proteinlike putative

Sequence
1068 bases(100 bases per row)
TACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCACCTGTGAGCTGGGGAAGCAAGA
AGCAGTCAAGTGTGTCGCTGTCTACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGCCTGCTGTGCGAGAT
TCTGGCGGCTGCCAACGAGACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCC
AAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTATTGCGAGACTTCTGTGATGCTGGCGGACATCA
TGACGAAGGCGCTTGCGGGACCACGCCACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGGGTATGGAGGGT
TACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTACGCCACTGTCGA
TTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGATGAAGTAACTCAGTATCCAGTAAAGAATCAAGT
AGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCAAGTGGTTTCCA
GTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGTCAGGAACACGCCAC
GCATGTAGCGGTTCCACGTCGCGTAGTTGTCTCCGTTGAACTTGTCGATGGAGACCTTGGTGGAGGCGTCGTGGGCAGAGGACATGGTGCTTGGGCTCAT
AACCTGATGGAAGGTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGC