Description :
From Genome Similarity Track
Location :
Scaffold_3659:6- 1040
Transcript NameFunction/comments
Phyag_g13356hypothetical protein

Sequence
1034 bases(100 bases per row)
TGGTGAACGCTGTTACAGCAATCATCGAATATACCATGCCACTTGTCGATGACCTGTTGACGGAGCTAGAGAGTTATCTGTGGTTCTGCTCACTTGACGC
TGCAAGTGGGTTCTGGGCTGTGATGATGACTTTACGTGCACGGAAGATTCCGGCCTTCGTTTGTGCATTGGGGCATTTCGAGTGGCTTCGAATGCCTTTC
GGATTAAAAAAATGCTCCGATGATCTACCAACGAATGATCGATAACGCCTTGTGGGGCTTTGTACAACCGAAGGGTGGCTGGAAACAGTTTGCCAAACGC
ATGGAgacagccgaagaagcgtCAAAATGTCTCCGGTCTAACAACGAGGATTCCGAGTTGCTGATGGACAGTAGACCGACAGCTCGAACGAAGTTCGACG
CTGACCATGAATCAACAGTGGACAGCGACCCAGTCTTGCAGTTGGTAAACAGCTCAGACGCGGACATGTGCGCGACGAATGAGGCAGACCAGTCAACCTT
GGTGCCTGTGTTTGAACGGCGTTCCTTCGTGGATGACATTTGTTTTGGCGCGAAGACGTTCGATGGTTGTTTGAACACTTTGGACCGACTGCTGAGCCGG
TTCGAAGAATGCCGCATCAGCGTGAGCTTCCCGAAGAGCACGTTCGCTCAGTCAAAGATGAATTTCCTGTCTCACGAAGTCTCACCTGAAGGTATCCGAG
CTGACCCGAGGAAGATGACTGCTATCACCGAGCTCTCGTTCCCAAGAACCAAGCGCGGGATGCAGTCGTTCCTGGGTGCGCTGAACTACTACAGCCGCTT
CATTCAAGACTTCGCAGTCTACGGTGCGGTGTTGTATCAGCTGAAGGAAGAAGATTTTGGAGCCGGGGGCAACCTCTCGGCAGCAAAAGAAAGTTtcaaa
gcgctgcagcagaaggtggcTGATGCTCCCATCTTGCGACGCTTcgatggcaagaaggacgtACACATCATGCTGTTTGCCAACGAGTGGGCGTTGAGCA
CGACTTTGATGCAGATGCATGACGACAAGTTCTG