Description :
From Genome Similarity Track
Location :
scaffold_715:6- 1034
Sequence
1028 bases(100 bases per row)
ACCTTGCTCCTGCATATTGATCGCGACACATTTTTGACTCTTAGGGCACGCAAATTGTCAAGAGAACTTCGGTATGTGTTGATCTGATCGAGTTTAGGAA
GCCAGGCTGATAACTGCATATTTGACACGAATTATAGCGAAAAAACGACCTTCTTAAAGGGGGTAGCGTGCTTTGATCAGTGGGGAAACGAAGCTATTTT
AAGTCTGTGTGACCGAATGGTGAGAATCGACCGCAAGTATAACGATGTCATCATTGCTGAGGGCGAACCAGCAAGTATGAATGCTCTAATTAAAAATTGT
GTTATGAATGCTCACATTGTAAACGAGCAGGTGGTTTTTTTTTTGTCAAACATGGCGAATGCAGACTTGTAAAGCGCTACTCGGCTttagagctcaaaaa
gaaacaGCACGATCGGAGATACCGGTGTTATGTTGAGATATCCACAATCAGCAGGTATATGCATTATGAGATTGACATGCTTCACAATCTAAACTCGACC
ATTTTGTCTTGTCAAGTCAACATTAATTTGGCTTTTACGAGGCGATTTTAGGCGTTGCCAACGCAGTCTTTTCTGTACTCGTATCTTCACCCTCGACTAT
CCTGTATCGTATTGACCGTGTTGATTTCCGACAACTTGTTTTGAAGGACGCCACAACTCAGCGAATCCTGCATCAGGAAGTCATAGATCTCTCTGCTCGC
GCCGATACTCGCCGCGTCATGATTGATTTAAAGAGAGATGCTAACTGGAATCAATACAAACAAAATTGGTGGGGATTGTTGTCTCAAGACGTGAGGAAGA
GCGCATCCCTTTTATGGGACCGCGGCCTAATCTTTGCGGCAACAGCTTGGCACGAGAGCCACATTTTTGTTTGCCTCAATTACCAGTATCTCTCCAAAAC
TCTCAAAGTGAGCGCGAGGTGCCAGGTGTCTCGTCTGGGCGACTTCGACGAGCGCGAAAGCCACTTATAAACGATTTAAAGTTTTTGTCACCACGCCGTA
TACATGAAAATGATGGTAGTTGATCTTT