Description :
From Genome Similarity Track
Location :
Scaffold_268:59992- 67518
Sequence
7526 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACATGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTTGG
GATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGGGAACCTGCAGGCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGTTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGTGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGTGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCGGTT
CCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGAGAAGATGGGCCACTTCAAGCGCGACTGCCCCGCGGAAAGACTCCGCAGATGGTCCTTTTCCAA
GCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGAAACGCAGGGAACCAGTAGGGGCAGGGCGCCCTACTGGGGAAGAACTAAGTC
TTCGTGATGGGTGCGCGGGTGGCGCGTACCAGGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAGT
ACACTGATCTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGC
AACGAGTTGTTCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGCGAAGGTCGTCACTGTCCCCAACGTCCAAGTGG
ATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGCTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAA
GCACGAGCCCTGGATCGACTGGCGAGGCAAGACAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGGTGAGTCACGTTCCCACCTCTGTCAGA
ACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACAGCTCCGAGGATGTTTTGATGGTGG
CCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCGTGTTCAGAGTGGGTAACAGA
GTTCCACACACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACAAAGTGCCACACGCGGTCGCCCAGACCTTAA
CGGAAGAGGAAGGCGTCGGATACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCACAGCGCCGACATCCCCAGACGT
GGGCAGCAAAGCTCCACGTCAAGGTCGCCGTCGACGACGACGCCGCCGCCACAAGTCGGATCCAAACTTCGTTCAGATCGACGTCGCTTCAAGCAACTCG
GAGTCCAGGTCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATGGCGAGGCCGGTTTACCCGTCAAGGCATCTGGTGTCCACT
TGGAGCCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAGCATCAAGGCTGGAGAGATTGCCGAGATGGT
GCTCATGAGACCTGAGACCATTTGGGAGGAGCTGAACCCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATAAACAAGCAGCGTCAGACGCGCTTG
GGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAGCAAACACCCACCGACCCAACTCCCACCGG
ATCGAGATGTACGGCGTGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAGCAGTGCGAGGTCATTGATGC
CTTCTTCGCCTCGAAAGCGAAGGCAGACATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCAACTTTTTTGCGTTCGGAAGCCGAACGGAAAGTGGCG
TCTAGTTCATGCTTATAACAAGCTGGACAACGCGACGATGTCGGCCCAAACATCAATCCCACGAAAGAATGTGTTGTTAAACAACATGGCCGGAAGCGTA
CTGTACAGCGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGTGAGAGAGCGACACCCCGCTCACCGCGGTGAGCACTCCAAGCGACATGCTTT
GGGAGTGGCTCATCATGCCGCAGGGCTTGTCTAACGCCCCAGCGACGTTCAATCGCCTGGTGACGCAACTGTTCCGCCCTTTGCGTACCTTCGTACTGAC
GTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCAAGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGA
GCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTCGAGTCACCAGAGACAAAAGTTCTCGGCTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCC
AGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAGCTACCTTCACAAGTACAGCTCA
GGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGG
CCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCT
GCAGGCCGACACGGCTGGACACGAACGAGTCATCTAGTTCCAGTCCAGGCAGCTCAAAGCCACCGAGCGGAACTACCCTGTCCATGAAATATGCCCTTGT
GAAGTTCCGTGTTCACCTTCTGGGCTCTAGACCCTTTGTGATCTACACAGACCATGCGTCCTTGAGGACGGCGACTAACTTGCGTCACCTCTCCCAAAGG
ATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCG
ACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATTCGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTT
CCTTAAGACCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGG
GTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGAGCTTAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCAAGCGGCCACT
TGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCGGTACGTCAAGACATGTGAAACATGTCAG
CGGGTCAAACCCGCAGGGCACTCTTTGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTTAAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTC
CCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACA
AACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCATGGTCTCCCAGAGACGATTGTCTCGAACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAA
ACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAGATAGAGCGCGTCAATCGAGTGCTCGAGGACA
CTCTGCGCAGTGTGTGCGCGGCAGAACCACGTACGTGGTCGACGCAGCTTCCAGTTGTGGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTT
CACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGATGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTTGGAAA
GCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGGTACCAAGCTGAACATTGTCAGCAGGGTCCGCG
ATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACGTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGA
CACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCTTCGGACCTTTTGCTGTCCTGGCCAGACATGGTGCG
TCGTACACCATCGACCTTCTAAAGTCAATGACGACACACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCAGACTCGC
AGACCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGATCACAGTTGTCGACGAGGGCGACGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGC
GGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGATGGATACGCACCATACGGGTACGTCTG
GGAGTGTGCTGCAGGCGGCCCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCC
ACCCGCAGGTGCAGGCTCGCGACCTCACGCTCCAACAGGTTTAGTTGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCAC
CGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGAACACGTTGACGGAGGAGGTCTACCTCAGGGCCCTGTGTCGGACCCGCAGGAGAAGCACTCGG
ACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTTTTACTCGTACGAGGGCACATCTGCTCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGCAGCG
GATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGAGAGCCGATTGAACGGCTC
CTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAACCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGA
ATGCATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACA
CGAAGATCACGCTGGTCCAAAATGTGGGACAGCTGCTGATCTTCATGGAGCTTCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCACGCCCAGA
ACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACG
ACAAGTCGTGAAGTCCTTAAGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGG
CTCGTTCATAGATGCCCCTAGAAGTGTGGCTGCCCACAAGGCCACGAGGAGCGACGAGGACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGG
CCAATACCCTCTTGAGTTGATGGTAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACATACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGG
TCGAGGTCATTCGAGACCCCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTTCTCTTCATCCGAGGAGTCGAAGATACTCC
GATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTTGAGGCCTTAGCACG
CGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCTACCGGCTTTGGGAGCGCCCTTAGCCTTGACGTCCGGACTCTCAGAG
CGCACAGAGGTCGAGGGACTGTGGTCACCTTGATCACTAGCGATCGATTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAG
AGCCCGCAGGAGTATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGTTCTACGAACCGAGGGTGCGGACGATTGTCTGA
AGATGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGCAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTG
AGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAG
GCATGATAACGGTCGAAGTGGAGACC