Description :
From Genome Similarity Track
Location :
Scaffold_15:5999- 10213
Sequence
4214 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACCTCTGTCAGGACCCGGGGCGCCCG
CAAGGCTGCCACGGTACCAAAGCATTTGGCAGATGCTTGGGAGGCGTCGACGTATATGACGACTCCGAGGATGCTTTGATGGTGGCAGCGCCCAGAAGAG
GCGCTGGCAAAGTGGGTATCTTAGGTCCACAGGCGGGTAGCTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGG
TAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGAGTAACACAGTGCCACACGCGGTCGCCCAG
ACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAAC
ACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTAGGCAGCAAAGCCCGACGTCA
CGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTTAAGCGACTCGGAGTCCAGGGCCCGGGCT
CCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGTGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGG
TTGCAGAGATACTGCTCCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACATCAAGGCTGGAGAGATTGCTGAGATGGTGCTCATAAGACCTGAGAC
CACTCGGGGGGAGCTGAACTCCTCCTCTGTTTTGGACGAGAATGTCCTGGAAGACCTGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTTAAA
AACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACG
AGATTGATCTCGTGCCCGGCACAAAGTATTGTGTTACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGC
GAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTGATAAC
AAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTAATGTATAGTGCGCTGGATT
TGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACAACCCGCTCACCGCGGTAAGCACTCCAAGTGGCATGCTTTGGGAGTGGCTCGTCATGCC
GCAGGGCTTGTCTAACGACCCGGCGACGTTCAATCGCCTGGTGACACAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTTGACGACATATTC
GTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAAGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCA
ATATCGACAAGTGCGCTTTCGCGTCACCAGAGATTAATGTTCTCGGTTGCTTCGTTTGCAACGTGGGCGTTCGGGCTGACCCAGACAAAGTCAAGGCCAT
AGCAGCATGGCCGATGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTAGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGTCTCCGCT
AAGCCCTTGTCGAGTCTCCTTGAGAAGGACGTCGACTGGCGCCGGGAGCAGGAGCAGTAGGATGCTTTTGACAGCATCAAGGCCGGTCTCCAAGAGGCCC
CTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGGTGCAGGCCGACACGGCTGG
ACACGAACGAGTCATCTCGTTCCAGTCCAGGCAACTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTT
GTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACACGCCTCACCTCTCCCAAA
GGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGCCGAATACAAGCCGGGCAAGCTCAACGTGCTCGCGGACGCCCTCTCTCGGCGTCC
TGACTATGAGTTGCCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAG
TTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCAATATGAGTTTAAAGAAGGTCTCCTCTATTACC
GGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAATGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCA
CTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCTTGTACGTTAAGACATGCGAAACATGT
CAGCGGATCAAACCCGCAGGGCACTCTTCGGCTCCATTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTTGATGAGTCTTGACTTCATCTTTGAGC
TTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGA
AGAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGG
AAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGTCAAACCGAGCGCGTCAATCGAGTGCTCGAGG
ACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGG
GTTTACGCCATTCTACTTGAACGGCTTCCGCCACCTCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGG
AAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGATCAGTTTCGCTGCGGAAACACGTGGAATCATTTATGGATACCAAGCTGAGCATTGTCAGCAGGGTCC
GCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAGCTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCT
AGGCACGAGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATAGT
GCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGCTCTATGTTGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACT
CGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCCGGTCACAGTCGTCGACGAGGACGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAG
GCACCGTACGCCGG