Description :
From Genome Similarity Track
Location :
scaffold_10:5999- 9188
Transcript NameFunction/comments
g631.t1 hypothetical protein PHYSODRAFT_505374
g632.t1hypothetical protein

Sequence
3189 bases(100 bases per row)
CCTACCTATTTATGGCGCCCATTTTTGATGATCTATACCTATTTCATGTGAGCAATCGTCCCGTCTATTGTTCGATTTTCGGCTGTCTATTGTTATTGCA
ACAGGAAGCGCCCGTCGCCAGCAGACCGTCGTCACCGGCTTCATTTCGTGGCAGTCCCAACCAAGTTCATTTACGAAAAAGCGTTATCCATCAAACATGA
CTTCGTCGCGCTCGAGTTCCAGTGCCGGATGCACGCTCTCGCTGCAGATGCAGCAACCAATGACCATCGGACAAAAGTACACAGGAAGTAGCCGCCGCCA
TCACTACTACCCACCGCCGACGCCGCGCAAGCTGCGCCAACGCTCCTGCCTGCGCAAGGACAGCGCATTTGGTGCCTCACGCGGCTCGAGGCTGGACGAG
CTGTCCACAACTAAGACGATCACGGTCAGCTACTCAGCCGCTCCCAAAAAATCTCTATCCTTCGCTGATCAACGCGGGCAGCACCTTGTGCTGGAGCGCG
AGTTCTGCCCCAAGGACGCACCCGTGTGCTACTGCGACGTCCCGACCGAGATTACAGTCGGCCGCCTGACGCGCCGTCGCAGCAGTAGTCTCGACAAGTG
GATCGAAGAGACTATGGCACGCCAGCACCTGCTTTCCATGTGTGTAGTCTCGCTGCTGGGCTGCGCGCTCATCGGCCTCCGCCAGACGGCAAAGTAGGCA
CATGTACAAGTACAAATTATTATCAGTGCATCGCTCAAGAGCGACACCAACTTATTACTGTAATACATCGAACACCTCAACTGTGGCTTGACCACACGTT
ATTTCCGGCGCTTGGTGGCCCATGTCTACCGATATCTGAGAGTTTCAGGCGGTGTTTGTCCAGTTCAACGCTCTGCTGCAGGATACTGCTGAGAATTAGT
TCAGGGGAGTACACCCGCTCTGGATTTGCGCGGGCAAGCTGCTTACGCACTGTTGCCACGGCCAACGCCGCTTCGCTTGTGATCACTAAGTCGTTAGTCC
CAGGCTTTCCCTTAGCCGAAGCCTTTCCTCCTGCGCACTCAACGATCTTCACCAGATCCTTCACTGGAGGCAGCACCGACTTGTGGTTGGTGATAAACAC
GCTGTAGCCGGCGAGTAGACGTTGACGCTGGGCCGCAGACACACCATATATAGTGTGTTTCAAGTCGAACTGCCACTTGTCTTCCGCCTCCTCGTCGTGG
AGGCAGTTCGCTTGCTCATCGACTGCGGTGCCGACCCGCGCCGACTTGTCAAGCCAGCGTTCGCCAAGAATATGGCTGCAGCACGAGATACCGCACAGCA
GTTTCACCGTGCGCTTTAGCTGATTCTGAGGAGCTATCACATGCGTAGCCTTCTCGATGTTGCTCTCGTATACAGCGCCAGCGATCGCCTTGATTTTCTT
GCGGATCGCAGCAGTGGGCTCTAGACCCGTCAGGATGATGCGGATTGATTCACCCTCGACTTGTGACCCTGGAGATTCGCTTTCTGTAACAGATCGACTG
CTTGGTGCTCGCTTCTTGCCGCGGCTCGAAATTGGTGTCTTCCGCGCCAAACGTGACGGCGTAGGCTCCTGTACATCCACAGCAGCGTCAGCAACTGGGT
TTGCTTTGTCTTCTAGAATATCATCAGCAACCTCCTCATCCGAGATACTCTGAGGTGCAGCAGGTTGCTTCTCTTGAAGATCCGCTGAAGGGTTTTGGTC
CTCCTGCGAAGCTGTCAGGTCCAAACTCCCTGAAGAAGTACTTGCAGTCTCACTAAGCCGAGACCGCTTAGCGTTCGCGTGATTCTCTTTAGGATACTCG
CTGCGGTCCCGCTTCGAGCTGCGGCGTCTCCTTTCTGGTGTTGAAAGTGATCGACGCATACTCGTTGTGTCCGGTGTAGGATCCTCTTTAGCGGTTGACT
TCGAGTAGCTGACACTCTTGGTTAGTCGCGGTCTCAAACTGCCCTTAGATGGTGTCCGATCGCTCTCCTTTACTGCCTGGAATTTCACAGGCGATTCCTC
TTTTGGTTCACATTCAATCTCTGTCTCTCCGCCACTGCTCTCCGAATTGTCGCGAATTGAAAGAGCTGGGGATGCTCGAAACGGTGTGCGCGGCTTGTAG
ACTCGCTTCTTCACAACTTCCGGTTCTTTCTCTCTCAGCTGAAAAGAAGCTGCGATAGAAGAGAACCCAGTAACAGAGCCGTCTTGCTCCAACATGTCGT
CGGACATGTTCGAATCGGCATCGTCATCACTGTTCCCCATTCCAATACCACCAAAGGATCTATATGTGCCGCTCTCTGCAGACGCTATCGGTAGTGGCAC
CGCCTCCTCAAAGATCTTCCGTTCTGGCTTGGGAGGTCCTAGAATCATTCAAGCCTTTAGTCATCTTCCATCGCTCACTACATCAGGCTCGCTCATACCG
TCTTGCTCTTCAGAATTTGTCATGCGAATCTGCGTCTCTTCCTCGTCCACCTCCTCTTCATCATGATAACCCTCTTGACTAGGCGTAGCAGCAACGAACA
ACGGCGCTTGCTCCTGATCCGGCTGAGTCGCCACTTCGGTCGCTACTTCCGTGGCTACTTCTGTTGCTTGACTATCGCGTTGCGTTTGCGTCGGTTCACC
TTCCAGCCGCGACAACGCGCCGCGTTTGCGGTAGTTGGCAGTATACCATTGACCTGGCGAATCTCGGAACCCCACGGGGGTGTCTTGCCCAGACGAATCG
CCGCCGTATACGCATGCGGCTTCGCCAGCCATACTCACACTCGTCAGTAAAATGCAAAATGCAGTAATTTACTGGAGATAAAAAATATGCATTTTGATGG
TATTTTGAAGTGACCAATCAGCGCAGTAGGATCGCTCCAAGACTGGTCGACTGTTCTAACGACGGCATCCTGTTCTTCTTTGACGACAACGATCGGAGGA
GGCCTCGGTTGTGGGCCGTGGAGATGTCGCTAAGGGAAATGTCCGCCGTCTTCGATGAGTATTGGGATGCACCAGGATGTGGAGACTCGTATTGTTGGTA
TTGTCAATTACCAGACGGCTTGACGATTCATCAAGTGGTCAAACCACATCTTGTGATACAAAGAGGAAGCTTTAGTAACGTGAGGTTGAAGGTATGGGAG
CTCACCATGTTGATCATGAACTCAATATGACTCAGGTGTATTCAAGGCAGCATCTTGTTTCACGGTAGATTGTCCGACTTGGGCTTTGG