Description :
From Genome Similarity Track
Location :
Scaffold_13:59982- 61644
Transcript NameFunction/comments
g18304.t1XP_009538566.1 hypothetical protein PHYSODRAFT_532724 [Phytophthora sojae
g18305.t1POM73915.1 Hypothetical protein PHPALM_9189 [Phytophthora palmivora var. palmivora

Sequence
1662 bases(100 bases per row)
TCGTCGTACTCGGTCTTCGAGATCCACATATGCTGGAACGTGGCTAGCGAGGCCAGGATCGAGCCTCCAATCCAAACCGAGTACTTGCGCTCGGGCGGCG
TGACGATCTTCACTTTCATCGCCGCAGGAGCCAGGTTCGTCATCTCCTTGGTCATGCGGTCTCCGATACCCGGGAACATGGTAGAGCCACCCGACAGCAC
AACGTTGTTGTACAAGTCCCGGCGGATGTCGACGTCGCACTTCATGATCGTCTGGAAAGCACATTCGTGAACGCCAGAACACTCACGGCCGATCATGGAG
GGCTTGAAAAGGACCTCTGGCGTTCGGAAGCGCTCGTTGCCAATCACAATCACATTCCCGTCAGGCAGTTCGTAGGCCTTGTCCAGTACCGACGAATGCG
CAGCTTTCTGCATCTCGTCGTCAAAGTTCGTGGCCACGTACGTCAACTTCTCCTTGATGTCCCGCACGATTTCTCGCTCCGCCGTGGTGGTGAATGAGTA
GCCGCGCTCCGTCAGGATCTTCATCATATAGTCCGTCAAGTCCCGGCCAGCCAAGTCCAGCCGCACAATCGCATGAGGTAGCGCGTATCCTTCGTAGATA
GGCACCGTGTGCGAGACTCCATCACCAGAGTCAAGCACACAGCCCGTAGTCCGCCCAGAAGCATACAGCGACAGCACTGCTTGGATGTTCACGTACATTG
CAGGCACGTTAAACGTCTCAAACATGATCTGTGTCATGCGCTCGCGGTTGGCCTTGGGGTTCAACGGAGCTTCCGTTAGCAGCACTGGATGCTCTTCTGG
AGCCACTCGCAGCTCGTTGTAGAAGGTGTGGCTCCAGATCTTCTCCATGTCGTCCCAGTTGGTGACAATGCCGTGCTCGATGGGATACCTCAGTGTCAAG
ACTCCGCGTTTCGCTTGGGCTTCATCACCAATGTAGGCATCTTTCTGGTTCATGCCCACCATGATGCCCAAGTGCTTCGGCATGCCCACAATGGACGGGA
ACACAGCGCGTGGCGCGTCATCCCCCGCGAAACCGGCCTTGCACATACCGGAGCCATTGTCGATCACCACGGCTTGCACGTCCTCGTCCATGACCAACAG
TCTTTGATCTGACCCGCTTGCGTTTTTCACGGTAAATTGCAGGATGAGCCTGTGTTGGAGTGAGACCAAGCTACAAAGAACAACTTCAACATAACGGGCG
GATCACAAGTTGCCATTGTGTACGCCACATCACACGCGGAGTTTCAGCCAATCGCAGCTCAGAAGTGAATCATCATGCTGGGGGGTAAGCCGGCGGCGCC
CAAGAAGCTCTCGGTGGCGCAGCAGGCGCTGCTGACGATGCACAAGATCCGCGCGCGGGGCTCGTTCCTCGTAGCAAACGCGCTGCTGCTGGTCGTAGTG
TTCTACACGTCGCAGCGCTTCCCGCACAAGTTTGTGCGCGTCCTGGGCGAGTACGTGGTGGCAGTTAGTTGGGTTATCTAACGGGGTTTCTAACGGATTT
CTATTTGTGCTATGGACATTTTTCGAACAGTTGTGATTCCAATTGGCTACATGTGGACGCTACAGAAGGGTCCGACACCATCTGCTGCAACAATGAGGAG
GGAGGATACGAGGACGCGCCGTGCTACACTGGCATGGACCTCATGCCCGTGCTGGGTTCACT