Description :
From Genome Similarity Track
Location :
contig_14:599717- 600804
Transcript NameFunction/comments
g3039.t1hypothetical protein

Sequence
1087 bases(100 bases per row)
ACGGAGAGGCCAAGAAGAACCAGCAGCTCAGTCTGGAGCTCATAGTCGCAGTGAACCAGAAGCAGAAACTCCAGGGTGAGCTGGAAACACTTGGCAGTCA
ACTGCGCTCACGCCAGTCTCAGGTCGATACACAACTCGCTGAGTGTAAGCAGCTTCGGTCGGACAATGGGACTTTGCGTGAGCAAGTGACCGGGTTTGAA
GCAAAGTTTGAGGCCATGCGCAAGGATCTGGTGCGCCGTGAGCTAGAACTGGAGCGTGCCGAGTTGGCAATGAAGAAGGAGCAACTGGAGACGCAGCAGG
CTGGACGAGATGCTGATACCAAGCGCGATCGCACAGTGCAGCAACTGGGTGGCGACCTGGAAACTCAGCGGGTTGGGTTTGCAGACGACAAACGCGCACT
GGAATTGCAACTGGAGCGTGTGCAGCGCGACTTGGCTCGGGAGTCCCAAGAAAAACAACATACGGTGACCGCTTTGAAGGCCAAGAATGAGGAACAGGAA
GAACTTGTGCTGGCTTTGGAGCGTGCGCGGCATGACTTACAAGCACAGCTTGAGACCTTCCGGTTGAAGCTTGCGCTTCTTCATCAATCAGGGAACGGCG
GGGAGGTTGGGAACGGAGGTGTTGGATTCAAGCACTTCGGGAGCTACTGGCGTCTTACCAAGTGCGTGAAAGAGAACTTCGAGATGAGCTTGACAGTGCA
CGGAGCTCTAGTTTGCGCCTAACGCGACGTCTTCGAGAATATGTTCACGCTACGAACAACGAGAACGATGACGGTCAGCATCGAGATCACGAAGCTGCAG
AAGGAAACAAGGATACCGGCAAAATTGAGCAGTTGGGTGAACAAGTTGCTGCTATGGAGCAGCAACTAGCGTCGGAGAGGGAGCAGCGCTCGGAACTAGC
ACTGGTACTTGCAGAGCTTGAGGCGCAGAATGCAGATCTGGTGCGAGAGCAGAAGGAGCGACGACAGTTAGAGGATGCTGCACCAGCTCGAGACAACGGG
AGTGGAGTCCGTGCCATCACTGAAATGCACGCAGCACTGACGCGTCAGCTTGAAGAAGTGCGGAGACTCACCCTACACCAGCAGCAA