Description :
From Genome Similarity Track
Location :
scaffold_55:59968- 61778
Transcript NameFunction/comments
Pl_110972U3 small nucleolar RNA-associated protein, putative

Sequence
1810 bases(100 bases per row)
TGAGATGGAAAGTGCTATCATCATGTCCATTTGCGCTGTGATTGATCACTTCCACTTCCAGGCGCCGGGTGCGGCTACGCAATGGCAAGTCTCGTCATCG
ACCACTAAGAAACAATCGGATCGCGAACCGACCGAAGCTAATGATGAGAATGTGGATGATGAAGAGGAAGAAGGCTCTTCCAAGGTCCAGGACAACATGG
AAACGCAGGTGCTTCCCATGCTGTACTCGTACTTGTTTAAGGGTATCGCTTCGAAGAAGAGCTCTAAGTCAAGGGGCGATGATGGCGAATCGACCTCACT
CTCTGAGGAAGCTGTGTCGGTGCGTGTGCCCCTGGCGCTTGCGGTTGTGAAGGTATTGCGTCGACTGCGTGCTGAAACATTCCAACGTGAGTTGCCCAAG
TTGCTTCTGAAGTTTGCCAACTTGTTGAAAAGTAAGGATGAGGCAGTGCGTGTTTCAGCTCGCACTACGCTTGTTCGAATTGCTGTGGAACTAGGTCCGA
GCTTCTTGTTACCAATTGTGGAGGAACTTCGGCACACGCTCCGCGATGGATACATGGTCCACGTGCTATCCTTTACCGTTCACGCACTTTTGGAAAAGCT
TCCAGAGATCATGCAGGTGGATGGCATGGCTGGTCCTCCTCGCAAGCCCCAATCATTGCTATTGACGCAAAACAAACAGCAAGAGGTTGAGCGTGAGGCT
GAGTTTGTGTCTCCACTAGACGCATGTGCACCAAGCTTGATGGAAATCCTGGCTGCAGAGTTGTTCCAGGGAATGACCACAGTCGGCGAGGCAGCGGAGG
CTGCTGCTGGAGGGGTGGAACATAAGTCAGCTCAGAAGTCGAAAATGAAAGAGGCACGCTCGAGTAGTGGACGGAGTTTGGATTCTCTGGAGTTGTTGGC
AAGATCTTTACCCTTCTTGCCAAACCCGAGCATTCACGAAGTTGTAAGTGCACTTGTGAAGCGCTTCCAGGCCACAGATGCTGGTGCTCAAGCTACTGCT
GCTCTGCAGGAGGCACTCAAGCGCGTGGCGATTGGTCTTGCGAAGAATCCGTCTGTAGAATCCTCCTATATGTTCCTGTACGCATACAACGTCCTCAATT
CTAGTCTTGAGAGCCTGCGTCCGGCCACCGAGAGGGAGAAGAAGCAGTACGAAGCTGGTGGTAGCAGCACTGCGCTTGTGACCTCGTGGCTTGTGTCAGA
AAAGAGTGCAGCAGCCACAAAACTGCTCGCAAAGCGAGTGAGTTCCCGAGAAACAGTTCGTGTCATGATGCAACAGCAAGTCACCGGATTCGACAAGATG
CGCCAGCAGCAACAAACCAAGACAAAAAAACAGAAGCGTGAGGAGATCGCCGCTCTTTTGGCCGAGAGCACAACACACCTCCGAGAGCTGCTGAACTTTG
CAGTCTTTCTGGTTTTCTCTTTTCTTCGTAAGAATGGAAACGCCAAGGATCAGGATGATGATAGTAAGCAGTCGAATGCGCCGGCTCAACTTGTGGATCC
GCTGGTGCCATTGCTCATGCGCTGTGCCGGTGAGTCGAAGAACGACCGCGCTGTTATCAATGCGCTAAAATGCTTAGGCTCACTGCTTCCTCGCCAGGAA
GAACTTCCAGCTCTACGAGTGGCACGCACACCGCTTCTTGATCGCCTTTTTAAGATTCTGCAACAGGCTGGAGCTGCTACTCGCAACGAGATGGTGCAGA
CGTGCTACCGCACGCTCACTGCACTCCTCAGACAACAACAGGGATTGGAGCTTGCTCAGGAGAACGGTAGCGCCTCCAAGGATGCCAATAGCGAGAATCT
CCGACTCACG