Description :
From Genome Similarity Track
Location :
scaffold_83:5996- 12912
Transcript NameFunction/comments
g3056.t1hypothetical protein
g3057.t1hypothetical protein

Sequence
6916 bases(100 bases per row)
CCGAATGGCCTCGGCCGCAGACCCTCGAGGCGTGCCGTGGTCCTTGCGCTGCTCTGACGGAATACCCTTAAGCGACGGGACGTGGCTCTCAGGCTCTGTA
TCGGAGGCCTCTGGGCCGTCGTCGCCCGGCCGGAAGAACGCCACGAGGTCTGCGAACAAATCGAAGCTCACCTGCAGGTGAAAGAAAGGTTAGTGTACAT
GTAGATTAACTACTGCAGTGGAGGAGACTGTCCGTCATACATTGAATGGGTAGACGATCTTGAACCGAACGAGCGCCTCCGTGAGCTCGCTGGTCGTCAC
GCCGATTCCTAACACATTGACCAAACCCAGTCGTGCTGCAACAAGTAGAAATATCAGGAGCTGCATACGCCAACAGTAGCGCATACATGTATTGCACGTA
CTCTGTGCAACCGATAGCAGGCCTCTGCCTTCAGCGTCAGCCTGAGAGAAGGCAGACCACAGCAGCTCCATTGGGTCGTCCACCTCGGCAGTGTCCCCAA
CGTCGCCGTCGCTCATATCCGAGCCAAAGTGTCCAAACTCATCGTCCGAGTCCCCCTCGTCTTCACCCTCCCCTCCATCTCCTTCCTGAACAGTTTCCAT
GCGCAACCCAGGACTCAATTCCTGCGGTATGCTCTGTGCTTTCATCTCCCGCGCCTTCTGTCGAGCCATCTTCTTCCGAGCTCGAGTTGCTTTATACGCT
GCCAATACTTTCTTTTGCATCGCCAGTTCCTGCGCAATCACCTCAGGCTGTCGGGGATCAACCACTTTGTAACATTCCTTGATCGCCTCGCGATCCTTTT
GCCACTGCTCCCACTTGGCCCAGCCACAATGCATCGCGTTCAGTTCAGCATCAGACAACGGCTGAATCTGCACGACCCGCCTCACAGTCGTGAATTCTTT
GTGTGCCATCATGCGCTTTGACTCACTGAAGTAGCTCGGGAGGTATTTGCCAGCAGTAGCCACAGGCGTTTGTAGTCGCACGAATTCCTCGAAGGGGGGC
TTTTGGTGCCCAGAGTCACCCCCACGTGCACTCCTACGTAGAAAAACACGGCGCTGGGAAGTGGGTGACCCCATTTCCGACATGGCACATATTTGGTTTT
CAGACCCTCCATCCTCTAGGTATTCTGTGATGTCTTGGGGTCTTAGGATCTCTAGCCCAGTACCATCGCCATGGAGGACGAAAATGTGGGGCTGAATAGG
TTCGTTAATGACTGCTTTTGCTGGAATACTATCCACATCGTACCGAGAGGCCTCAGCATCACTTACGACTCCAGCAAGGTCAACAGAAACGAGTGGCCCC
GGCTCCTCTTCTGTTCCGTTGAAATCAACGTGGAATTGGTTCTGCTCGTTGTCGCAGAACTGGAATTGGCCAAGCCGATAGTCGAAGTAATAGACCCCAT
TGTGGCTTGTCACGTTTCGATCGTCTTCATCTTTCGAGTCAAGGCCACTTCGATCTTCGGAGCTGTATTCCACCCTCCCACTGTCTTTTGCCACAATGAC
TTGTCCATTGGGTTTCCGCGTTGTAACACGGCCATTCACCTGCGCCGTCACCTTTGTGTTGTAGCTGATCTCCACACTCGTTCCGTCATACACATTCACA
GCACAACGCACACGTAGCCCTCCTTTCCTAACTGCCACACGCTCTCCTGCTGCATGGCATTGAGCTGTCGCATTGACTTCCACATCGATGCAGACGTCGG
CAAACCCTCGCTTCGTTACAAGTACGTGTGGGCTCCCAGCATTCATGTACATTCTTGTGCCATCCACATGATACGTCACACGAGCCCCACTCGTGAATGT
GACAACAATGACGCCGCTGGGACGTCGCTCTACCAGTGCATTAGTCTCGGGGTCTACTGTGAGCGTCGTAACTGTTGGAGGGTCAAGTTCTGTAGTATGA
CTGGCCCCCTTCCTCGAGTTGTGGCGGTGTTTCGTACAGCCACGAATAACACGTACAAGTCCACTTGCAAGCAAAACTTCTTTTCGCCCGCATCGAAACA
CCCGAAGAACGCTCCCCTTTCCGTAAATCACACGATACTTCTCACCTTCATTACTTTCTCGCAGCTCATTCAAGTCTCCCACATTGCCTGCAACTCGATC
CAAAGACTCATTTGTGTCACTAGCCATGAAGCTGCTGCTCCATCCTGCCAAAGCGTAACGCTGAATGATGGTGCCATCCGAACAAGCAGACACAATAAGA
CCATTTGGAAACGAGTTAGTCATCGTGACAGTAGGGAACTTGTCAGGCTTTTTAGGGAACTGTCTCCTTCCCTCGGAAATGTGCAGTGTAGACTCGTCCT
GGAAGGATGCAACGAAGTGCATCGTAATCTCCGAGCTTTGTTCCTCATGAACGATTCCATCACCTGAATTCCCCGTCCCCGATCGTAATCCAAACGTTTC
CCTGGAGAAATTACAAGCGTTAGTTGAGGTAGTACAACATCAAGCAAGACACAACGCACCCATCGCGATAGACTGTGAGCCATACCAACCCTCGAGGTGT
CTGATACAGCCGCACTACGCTGTGATCAGCAGGATACATCGCCCAAGTTTGGACACCCACAAGCGCAAGCTGCCCAGCTGACAATGGGATACACGCACGG
GCTGCAGCTTCAGTACGTGGTGTAAGGTATTCGTTGGGAGCAAGTTCCTCGCGCTTCCAATATTTGAATGCTGGTCGGTGACGTACGTGGTCAACCGCTG
CCCATGAAGACACTTTGATTCTGCCAGGAGCGGTTTTCGGGAGAGTCGCTAACAAAAGCGAATCCGTAGGCGCGTAGTATCTGGAACACACATCGGGCGA
GTTTTGCTGCAAAACCCACGCGATTCGTTGGGGGAGAACTGCACGCGTCAAGTTTTCCATAAAAGCGCGGGATTGTAGTTTCCCCCTCCAGGAGCTTCCT
AGCATCTCTTCGACTTCCAGAAGTTGCTGTGTTAGATGGACCATCCAGCAACTAAATCGAGGTGAGTCGTAGAATGTAGCAAGCTCCGTGTTGCGAACAC
AACGCTCCGGCTCAGATAACTCTGGTACTCGAGGCATTGCCTTCCGTCCTTCGTTACCTACACCCGGCAAATCACTTTGCCTCCACATAGCTCGTTCGAC
ATCATCAAGGCGATGGTTCCCGTGGGGTATGAAGCAGGAGTCCCCTTCCTCTTGCAATGATTCGTGATAAAGCTGAGCACCTGCAAGTCGGCATGAAACT
AAGTCGCCATACTCGAGGAACTCCTCAAGTTGATGTGGATCTGCCTTGTTATTTGGACTGGTACGGTGTTGTGGAACTGGTGTCGTCACAACGGGAGATA
CCATCGCCACAGCCTCAGCGATAGCAAATAAAACCGTACTGACGCCAACACTGCCAGGATAAACACCGCTTAGCACTGATCCATACGCTTTGCAAAGCGC
ATCCCAGTCGCCCTCATTATCAGCCAAAAGAGGAAGCTCAGCAAATGTTGTTGACCCTACCCAGTCCTTAAATGAGAACTTCTGAGCAGCAATCGACTCT
ACAGTTGTGATCAGCTCCTGCTCAAGCTCGTCAAGCGGTTTGAGCTCCGACGCTTCTGTGCTGCAGCCTACGTCCGTGAAAGTAAAGTCGCTCCACTCGA
GTCCTCCCGCCTGAGCAGCCTCATAAAACACCTTCACAACAGAATTTGCTACCTGAAACACCGACGTCTCCGTCATCGACGTTCGTGGAGCATTGCGCAT
TTTCACAACAGATTTACGAGGCGGATTAGTTGAGCTGCTTCTGTTTCGAACCCGACCTGCTGACACGTCCAGAGGATCAGCTAGAAGCACCACCCCGTCA
ATCAGCGGTAACAACGGCAAATTTTCGGGTCCGTTCGTACTGCCAACCTCTCCCAGCCTCAACAGTTCGTCTATCTCGGACAGGGAAGAAGGGTAGTCCA
CTAAGAGGTATACGCGCGCAGGTGTCTGCACTGATTCTCTGTTCCTCTCCGCGTACTTTTCTTCTGCATCTCCCCCTCCTTCATCTGGATGTGCGTCTGT
CTGCTGATACGCGAGAAATTCTCGCTTTTCCTGACTGACAAGACGCTGGAACGCGAGTGCCAGCAGCGACGGCGTCACAGTAACTCGCGCAATCTCTTCC
TCCTCCTTCTCCTCTGCATCTCCTGGTCTAGCACCCTCCTCTACAGCAGTGTCCTCCTCAAGTGCCTTATCTTCGTGCTTTTTGGCCTCTAATTCCTCCG
CATACGTCACTTGCACGAGCTCCTCCAGCTCTGCGCGACCCACGACGCGATACGAGCAGCTCCTCGCCCAGCTCGACAGCTCTGCGTCCGCCTTCAGCCT
GTTCAGCAGCCCCTTTCTGGCCGCCAGCTCCTCGTTCGCTGAGCCGCTGGCGAGCGCCACCGCGTGGAACCCCCAGCGCCTCCTCATCATTATCGTTGAA
GTTGGAGGCCCAAGTGGAAGTTGTCCCTCTTAAGTGCGATCGAGCCAAGTCGACTCAGAAGCGGATCAGACGGCAATGGTCCTCGAACGTCTGCTGCTCG
CGGCTTGTGTGCTCGTTCTGGTGGCGGCCGATGCTCCATGCGACGAGAGGAAGCTGCACCGAGACGCTGTGGTGCTACTGGCAGCTCACGTGGACGTGGA
GATGGGCGGCGTCGGAGCAGGCAAGCGCGAGGTCGTGGGTTTTCAGTATTTGGTAAGGAAATGGTGAAAAACACTTCAACAACTACAAATCGTGTTAATT
AACGGATGATAACGACGCAGAAACCTGCTGAGGCTCTTTTGGCAGCACAAGCGCTGGCTCATGAGGACTTCAACCAGGCAGCGGGACAGGTCCAGCGGAT
CCTCGAGTACCAGAAGCCAGACGGGTTACTGCCGCACTTGGTCTACGGGCCGTCCGTTCCGTCCAAGCTGCGGTGGATACCGAGCAATCGCACCTTCCAC
CCAGGTCCAGCGTTCTGGCAGCAACCGCTCGAAGGTCGGGAAGAGGAGAGCCCCATCTCGCCCCTGCACACTTCGACGATTTCGGCTCCTCCTGTGGCTG
CAGATGTGGCGTGGGAAATCTTCCGCTTGTCTCCGTACGACTCGGTACTGGGTGTGAGGACCACCGCTGTGCAGTTCTTGTGCAGCGTTTATAAGCCGCT
CAAGAAGCTGCAGGAGCGCTTGTTCTTCACACGGCGAGGCCCCTCTCCTAGCAGTTTACTTACTGCTCGTGTAAGATTTACTACGATCCGTACATGACAG
GATGGAAACTAATGCTCAGGTGTATCTTACGATCGTTCTTGCAGCACCCCTGGGAAACGTTTTCGCCACTATCACCACACTGGAAAGCATTTCTCGCTGA
ATTGAAAAATGCGCCAGACTACGACGCAACTGTCAAGGCTATCCCCGACGAAGCCCGAGCTCGCTTTGCAGCTGGAGCTAGTACAATATTTTCAGCGCAA
GACGCAGTTGAGAATTTGTATGAGCCTATGATTTATCTCGCAGCTCAGATGCGCCGCGGAGAAACCAGCGAGAACTACCGTCGCGAATCAACCGTGTTGG
AGTCCATCGCCTACACTACGGATGGTGACAAAATTGTTCAATTCGGGGTCGAAGATGTGGAATTCAATGCGCTTATGCTGCGATCGTCTTTGGGTCTTGT
GAACATCGGTCGCGTGCTCCTGGAGCACTCGTCCGTGTGCACGGGTTTCACGTTATCTGAGGAAGAGCTTCTGAGTGATATGAAAGAGCTTCATTCGATG
GCGAAGGGCCTCGAAGGGGCTCTCATTGGCACCAACACCACTCAAGGCCTGTGGAACGCATCCGCTGATTTCTTCGCTGACTCTAGCAGGTTCTCATTGA
CCTCAGCGCACTCGTTGCGCGGATTTCTTCCTGGATACGCTGCAGAACTGGACGATGACAAGAAAATGCGCGCGATGAAGCATTTTCTTTCGGAACCAGG
CACATTTTCTTTCTTTTGCTCCCAGTTCCCAGCTTCATTTTTTGCGTGCTCTGGAGGAGATTCACTCGAAAAAGTTGATGGATCGACGAGCGGCAGACCA
GCAGCCACAACGTGGATCCTCTACAACTATTTTTTGCAGCGTGGGTTTGCTAGGGTACGTGTTACTCCCCACTCCGAGTTTTGATGAAAACATTAACTTT
GTATAACATTCAGAACAAGTTTCCAGGACTGGCTGATTACATCCGCAACAAGACTCGAGATATGGTGTGCGAGGCAACAACAGCTTCTCCTCAACCATCT
CTTTCGTGGTTCTCATTATCGTTAACTGCGAATGAGGCCGCACCCACAGTTCTATCTCTAGCCTATGACTCCCACAACGCCACACCAGTCCAAGTTTTCG
ACGAGAGTTATATCGGATCAACGCTCTCCGCCGCCGCACTTCTTAATGTGCTGTTGCCAGCAGGTACAAGTAGTAGGCTTTGGATACGCAGTGGTTCTCT
ACAATGCCTTACCGGTAAATTTTTTTTTTTTGATGTCAACAGTGACTCCGCCACCAAGTCCAGATACGCCACCCATTGATCACCGCATTCTCTCTGTTAT
CATGTGCGTCGAGCTAGTTGTCGCGTTTGGAGTCGCGATGAGCTGTTTCCTGTTTTCGGTATATTTTGTGGCGAATCGGCCACGAGAAACACGACCATCG
TCTGCGTCTGCAGCACGCCAAAAATCGGCTGGAGGAAAGAAGCCTCGAGACAAATTGGATCGCCGCACGGAAGACTTGGAGGGCCGCGAGCAATCCAGTG
CCAGTGGGTCGTCGTGGGCTGAAAGGTACTCGGAGTCATCTTACAGTGACTACTCTCCGCGATCTGGCCACACGCCGTATGAGCTAGAGGAGTCGTTGAT
TTCGGAGGAGGACGAGCATTACGGATCCTTCGACGAGGCAGCACAGCCGGAGACACCGTCCAATTCAGCATGGAAAGCCGCGAAAAAGGCGCTAGCGGAC
ATCAGTCCCTGGTAGA