Description :
From Genome Similarity Track
Location :
scaffold_25:59948- 61418
Transcript NameFunction/comments
g2788.t1 hypothetical protein PHYSODRAFT_370933
g2789.t1 hypothetical protein PHYSODRAFT_514023

Sequence
1470 bases(100 bases per row)
TACAGTAAGCGCTCTCTGTTCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCG
GGAATCGCCACGCACCATTCATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGATGAGGATAGAGCAGAA
GAGAGGTCTTATCAAGAAGGCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTGAAGCGGGCGCCAGCT
CAAACAACCATTTCCGACATCCTCAAGATGGCCCCGGCAATCATGAGCAAGGCGTATGGGGACGGCAAGCGGCGCTAACCGCTGAAGGTGACCTCGGAGG
CGCTGGGAGAGCGCCTATGGGAGTGGATACAGAAACTAGAGGCGTAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAGCGCGAGATTTACAAAA
GGAGCTATGTGATGCTTGGGAGCTGTCCTTTTCGGACGGGTGGCTCACTGCATTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCACGACCTGGAGAAGCT
GCATCGGTCGACCCTGAAGTCGTTTGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGATGACGTCTACAATATGGACGAGACGG
GGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGA
TCCGACACGCTGCCGGCACTCTTTCTTGGTCACGCAAAGCAGCCCTACTGTCTCAACAAAAGCACGGTGGCACAACTAGGCTTCTCGTACCGCTCGAACA
AGAAATCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGGGCCGTCAGATCCTGTTGCTGCTTGACAA
CGCATCGTCCCACCACTGGGGCGATATCGTGTGTACTAACGCCCGCGTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGCAGGA
ATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTG
TCGACCAGCTACAGACAATGTAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCACACTGGAATAGTTTT
TAATGCTGTAGATGAGAGGGACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTTGAGTCTTTAAGTAGC
CGACGATAATGCACAGCAAATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTA