Description :
From Genome Similarity Track
Location :
contig_115:59943- 64339
Transcript NameFunction/comments
g13813.t1hypothetical protein

Sequence
4396 bases(100 bases per row)
TCTATATGGGAAGTCCGCTGAAGAATTGGGGTCCGTGCTGCTAAGGCCCGAGCGTGAAGAGGACGTATCAAACTATGTGCAGATGATCGGCCCTTGCCGT
CCTTTCACTAGCCGTGCGAAGCGAACCGGTCTTGCGGAGACTGTCACGGTCAACCTGCCGAGAGGTTTTGGTATCCAAGGAGGTGAGGAGGAGGTGGAAC
CGCTTCGAGTAGAGAAGAGTGGTCGCCGTGTGGTGTGCTCTGTAGGCAGCTATGAGGCCTTATCAGGCGGCTTTATTGATTGCTTGCCTTCGCATATGCT
GGCGGATACGGGTGCTACACTGAGTCTAGTGGACAAGTTGGTAATGAGGCGATTAGGGCGGTCTACTGAGCGGCTGGAGCCCTACGACGGCCGAGTAAAA
AGTTCGTCCGGTCATCCGGTGCGCATTCGTGGCTGGACCAGTCTTCCGGTGCGGCTCGGTTCCATGGAGATCTCGCTCCGAGTCTTGGTAGCTCACAACT
TGCATGTCGATGCGATTCTGGGAGTCGATGCGCTTGGCGCGTTCGGCGCGGTGATTGACGTTGCGGAACGAACCATGACTTTAAAACTCACCGGGGAAGT
ATTGTCGTTGGGCGCAGCGGTGGTTCATGATTCATTTATGGCAACTATGGCTACTTCGGTCCGGTTGCCCCCGCTCGGTCAAGCACTGGTGACGACGGAG
GTAGTTGGAGAGGTTGACGACCAGTCAACCGTACTTATTGAAGGATCACTTGGATTACCACCAACTCTGTGTGTGGCCCGCTCACTGTGCACAATTGAAA
AAGGAAAGGTCATCGTAGAAATTTGCAATGCGACCACGGATGAGATATGGATTCGAAAGGGAACGGTAGTCGCCTCGACGTCAGTGATTCCTGAGTCGGC
CTTTAGCTTTGAGAAGCTTCGCGCGGACGATGAACCGGTATTGGAGATAGTGCCGGCTGAAGATCGTCCCCCGGACACGGTAAAGTCAGTTGCTGAGGTG
CCGACGGAGCGGGTGGCTCAAAAAGGAGGGAATATGAAGGCCGACTTTTCACAGTCAAAGTTGTCAGCGGAGCAAAAGGCCTTGTTCCAGACGGAGTTAA
ACCGATTCGATAGTCTGTTTGTCGAGTCCCGGACGGACAGATCTACTAAACTTCCGTATTGACACTGGACCTAATGCGCCTATCAAGCAGCAACCGTACC
GAGTATCGGTAGCGGAAGGCGAGGTAATGGAAGCCGAGATTCAGCAGTATCTAGAACTCGGGATCATTCGTCCGTCGATCAGCCCCTGGGCTAGCCCGGT
GTTGATGATCCGGAAGCCTGACGGTGGAATACGATTCTGCATTGACTACCGACGGTTGAATTCCGTGACCGTGAAAGACTGCTACCCTATGCCTTTGATC
GACGACATCCTGGATGTTTTGGGTGATGCTCAGTTGTTTTCGACCATGGATATTGCGTCCGGATACTGGAACGTGCCTATGGACGAGGACAGCATCGCTA
AGACGGCCTTCACTTGCAAGTACGGTCTTTATGAGTGGATGGTCATGCCCTTCGGTCTTTGCAATGCGGTAACGGCATTTGAACGGTTGATGGAGACTGT
GCTAGTGGATCTCAAGTGGCGTATTTGCTTGGTGTATCTAGACGACTGCGTCATCTTTAGCAAAGATTTCCCGTCGCATCTGGTCCGTGTTCGACAAGTG
CTCACAAGGTTCCAACAAGCTGGTTGTAAGCTGAAGATGAAAAAGTGCCATTGGGGACGGAACCAGGGTAGCGTTCCTCGGTCATATAGTGACCCCGACC
GGTATTCTCCCGAACCCGGAGAAGGTCAAGGCGGTGATAAACGTGGCGAGACCGCAAGATGTGCATGGGATTAGGTCTTTTCTCGGTCTAACCAGCTACT
TCAGACGATATATCCCAGGGTACGCTTCGATTTCTGCGCCGTTGGAACGATTGAAGGTGAAGGACGCTCCGTTCGATTGGAACGCTGATTGTGAAGCCGC
TTTTAGACAACTCAAACGTGCATTGGTGAAGCCGCCTATCTTGATCTATCCCAACTCAAAAAGACGGTTCAAATTGTTTGTGGACTCGTCTCGGTATGCC
GTTGGAGCGTGCCTCATGCAGGAAGCAAACGGTCGAGACCGTGTCGTCGCCTATGCTAGCAAACTCCTGACCGGTTCCCAGAAAAATTGGATCAACAAAA
CGGATGGAATCTCCGAGATCGAGTGTTGGGGTGTTGTATGGGCAACACGAAAGTTTCGATGTTACTTGGATAAGCGCGAGTTCGACCTCTATACGGATCA
CCAGGCTTTGACCTGGGTATTCAACCCTGGAAACCGTACTACGAACGCTAAACTGGCCCGTTGGGCGATGGAGTTGTCGAACCTGCAGTTCAAAGTGCAG
CACAAGCCTGGAACGATGATGGGGCATGTTGATGGTCTCTCCCGACTGCCTACTAACTCAGTAAACGCTTTGACTCTAGCTGACTTGTTGAACCCGGTGG
AGATCGCCGATAACGAGACTCTCAACTTAGTCGGAGAGCCTCATGAACCTGAGGGACTTTCCGGTGGACCGTATGAGGGTGATATTGACACTGAGGAGAA
ACGTGAAGAGTCTGACGAAGAACAGGCTGATGTCAATCACGGTCCTGGTGAGGACGGTCCTGGGTTGGACGCTTCGTGTCCATCCGTCGATATGTTCGGA
CTGGATAGCGAACAGTTCTGGATGGAGCAGCAGTCTGTGTCGTGGATCAAGGCTCTGGTAGCTTTCTTGATTAATCATGCGCTCCCCTTGGACCCGTTTC
TGCGTGCTCGTGTGGTGAAGCTAGCGCCTAAATTTGACGCGTCTGGTGGTCTCCTGATGAGACGTGTGAACTTGCCGGCCAGAGTAGGCCCGGCACGATC
GTTGACCGTGCCTGTGATACCCTTACCGTACGTGCAGACGGTCTTACACTTCTGTCATTCGGATTTACTGTCTTCACACTTGGGGCTCACGAAGACTTTG
GAGAAAGTACCGACACGCCTATTGGCCTGGATGGCGGAAGGACGTCGCCGAGTATATAAGAAGTGCAACAAGTGTGGGAGCGGTAAAGGACACCGTCCAT
GGAACGCTGGGCTAATGCAACGGATGCCTGTCGTCGACTTGACCGGTCCCTTTTCGTTATTGGTGTGGATGCGATTGGTCCTCTCCCGGAGACGGACCGG
GGCAATAAGTATATCCTGGTGTTCGTGGATTACTTCACTAGATGGGTAGAGGCGTTCGCTGTCAACCGTCTAGATTCGGTGACTTCGTAGAGGTGATGGT
GAACGGAGTGGTCTCGCGGCACGGTGTGCCTGCCGGTTGTTAAGTGACAATGGGTCGAACTTCACGTCGGAAGTGGCGAAGTCTTTTTATCAGACTCTTG
GAATCAAGAAATTGTACGGTGCTGCGTACCATCCTCAGACACAGGGCCTGGTGGAACGGTTCAATGGCACGCTTATCGGGATGTTGAAGATGCATGTGAG
TGAAGCTCAGACGGATTGGGATGTGTATTTGCCTAGAGTGTTGTTCGCCTATAGGACGGCTTACCATGAAGCACTGGGTGACTCTCCCTTTTTCTCTCTG
TACGGTCGAGATCCGGTGTTGCCGCTGGACGTTGCGTTTTTGAATCTCGGGAAGAAATGGAGAAGTAATGAGGTGGCACGGTATCGAAGGGAACTGAACC
GCTCTCTGAAGGACTCTCGGCATTTGGTAGAACGTCAATTGGTGAAAGCACAGGATCGTCACGAAAGACGACTGCGAGGACAAGTCGAAGTGAAATATGC
TGAGGGTGACCAGGTTTGGGTGTACCAACCGTTCCGAGCCAAACGAGGAGAAGTACGAACGAAGAAGCTAGCTTTTTCCTGGCACGGCCCGTACCGTGTA
ATAGCCAAAGTCGGGGAGAACGCGTATCGGATCGATGTTCCGACGCACCCTGCTAAAGTGGTTCCAATCAATGCCAACCGGTTGAAGAAATACCGTGGAA
GGTGGACTCGCCCCTATGCAGATGATGTGCCTGAGGGAATAGAAGAAAACGAGGAAGCCGAGGATGGGCCGCTTGAGGGGTCGGACTTGCCACCGTCCAG
TTTCACAGAAAGACTGACGGTTGGGCGAGGGGACACGGTAATTGTAGGAGTGGATTCTCCTTTGCTAGAAGTTGTGGCAAAGCGGACGGTGGATCGTACC
GTCGAGTATCTGGCTCTGACTGCGAATTATGAAACGTTTTGGTTGTCGCGGGTGGTACTTGTGCCCGAATATGCGGATCTGGTCACTGCTTTTGAGAAAG
CAGAGAGGGCCAAAGGACGGTTGCCTGCGTTGCGTCGAAGTGCTCGCTTGGCGGATGCCAATGCGGAAGTCGACGACGCAGACTTATTGATGATGT