Description :
From Genome Similarity Track
Location :
contig_25:59935- 61405
Transcript NameFunction/comments
g6062.t1XP_009517210.1 hypothetical protein PHYSODRAFT_323385 [Phytophthora sojae

Sequence
1470 bases(100 bases per row)
TACAGTAAGCGCTCTCTGTTCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCG
GGAATCGCCACGCACCATTCATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGATGAGGATAGAGCAGAA
GAGAGGTCTTATCAAGAAGGCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTGAAGCGGGCGCCAGCT
CAAACAACCATTTCCGACATCCTCAATATGGCCCCGACAATCATGAGCAAGGCGTATGTGGACGGCAAGCGGCGCAAACCGCTGAAGGTGACCTCGGAGG
CGCTGGAAGAGCGCCTATGGGAGTGGATACAGAAAGTAGAGGCGCAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAACGCGAGATTTGCAAAA
GGAGCTATGTGATGCTTGGGAGCTGTTCATTTCGGACGGGTGGCCCACTGCGTTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCACGACCTGGAGAAGCT
GCATCGGTCGACCCTGAAGTCGTTGGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGAAGACGTCTACAATATGGACGAGACGG
GGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGA
TCCGACACGCTGCCGGCACTCTTTCTTGGTCACGCAAAGCAGCCCTACTGTTTCAACAAAAGCACGGCGGCACAACTAGGCTTCTTGTACCGCTCGAACA
AGAAAACCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGAGCCGTCAGATCATGTTGCTGCTTGACAA
CGCACCGTCCCACCACTTGGGCGATATCGTGTGTACTAACGTCCGCGTAGAGTTCCTGCCGCCGAATACCACGGCATTCCTACAACCCATGGACGCAGGA
ATCATCGCCGCGTTCAAGCGCGCGTACAAGGGAAAACAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTG
TCGACCAGCTACAGACAATGCAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCACACTGGAATAGTGTT
TAATGCTGTAGATGAGAGGGACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTTGAGTCTTTAAGTAGC
CGACGATAATGCACAGCAAATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTA