Description :
From Genome Similarity Track
Location :
contig_25:59935- 61405
Transcript NameFunction/comments
g5781.t1hypothetical protein
g5782.t1RAW27698.1 hypothetical protein PC110_g15902 [Phytophthora cactorum

Sequence
1470 bases(100 bases per row)
TACAGTAAGCGCTCTCTGTTCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACAGCTTCACTTATGGCG
GGAATCGCCACGCACCATTCATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGATGAGGATAGAGCAGAA
GAGAGGTCTTATCAAGAAGGCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTGAAGCGGGCGCCAGCT
CAAACAACCATTTCCGACATCCTCAAGATGGCCCCGGCAATCATGAGCAAGGCGTATGGGGACGGCAAGCGGCGCTAACCGCTGAAGGTGACCTCGGAGG
CGCTGGGAGAGCGCCTATGGGAGTGGATACAGAAACTAGAGGCGTAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAGCGCGAGATTTACAAAA
GGAGCTATGTGATGCTTGGGAGCTGTCCTTTTCGGACGGGTGGCTCACTGCATTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCACGACCTGGAGAAGCT
GCATCGGTCGACCCTGAAGTCGTTTGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGATGACGTCTACAATATGGACGAGACGG
GGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACGGCAAATGCTGATGGA
TCCGACACGCTGCCGGCACTCTTTCTTGGTCACGCAAAGCAGCCCTACTGTCTCAACAAAAGCACGGTGGCACAACTAGGCTTCTCGTACCGCTCGAACA
AGAAATCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGGGCCGTCAGATCCTGTTGCTGCTTGACAA
CGCATCGTCCCACCACTGGGGCGATATCGTGTGTACTAACGCCCGCGTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGCAGGA
ATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTG
TCGACCAGCTACAGACAATGTAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCACACTGGAATAGTTTT
TAATGCTGTAGATGAGAGGGACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTTGAGTCTTTAAGTAGC
CGACGATAATGCACAGCAAATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTA